fruit firmness after storage, q.FRFRMAS.RB-RG1.Hawke's_Bay-2011 (QTL) Malus x domestica

QTL Overview
QTL Labelq.FRFRMAS.RB-RG1.Hawke's_Bay-2011
Published SymbolN/A
Trait Namefruit firmness after storage
Trait AliasN/A
Trait StudyApple-Envirnonmental_Interaction_Phenotypes-Tustin-2014
PopulationRoyal_Gala
Female ParentN/A
Male ParentN/A
Colocalizing MarkerGDsnp01815
Neighboring MarkerN/A
EnvironmentN/A
LOD4.36
Additivity Dominance RatioN/A
R226.4
CommentsN/A
Alignments
The following features are aligned
Feature Name Type LocationAnalysisReference
Chr01chromosomeChr01:15830675..15830775 .Malus x domestica GDDH13 v1.1 Whole Genome Assembly & AnnotationGDR QTL alignment to genome using associated markers
Map Positions
#Map NameLinkage GroupBinChromosomePeakSpan StartSpan StopMapViewer
1Apple-Rg-F1-2014RG1N/AN/A8--View
Sequences
The following sequences are available for this feature:

QTL from alignment at Chr01:15830675..15830775

Legend: genetic_marker
Hold the cursor over a type above to highlight its positions in the sequence below.
>q.FRFRMAS.RB-RG1.Hawke's_Bay-2011 ID=q.FRFRMAS.RB-RG1.Hawke's_Bay-2011; Name=fruit firmness after storage; organism=Malus x domestica; type=QTL; length=101bp; location=Sequence derived from: Chr01:15830675..15830775 (Malus x domestica
TGTGGCTAACGAAAGTAGTTAATTCATCTTATCGTGAGGTACTTGTCTGC TGTAGATTTCTTCTGGTCCGTATTTAGGTTTCACCCATTGTCCTCTATTA C
back to top