flesh browning rate, qFB.FjxPL-LG16.T0a (QTL) Malus x domestica

QTL Overview
QTL LabelqFB.FjxPL-LG16.T0a
Published Symbola_T0-LG16
Trait Namefruit flesh browning rate
Trait AliasN/A
Trait StudyApple-Flesh_browning-Guardo-2013
PopulationFuji_x_Pink Lady
Female ParentFuji
Male ParentPink Lady
Colocalizing MarkerGDsnp00047
Neighboring MarkerN/A
EnvironmentN/A
LOD3.85
Additivity Dominance RatioN/A
R231.4
CommentsN/A
Alignments
The following features are aligned
Feature Name Type LocationAnalysisReference
Chr16chromosomeChr16:3856478..3856578 .Malus x domestica GDDH13 v1.1 Whole Genome Assembly & AnnotationGDR QTL alignment to genome using associated markers
Map Positions
#Map NameLinkage GroupBinChromosomePeakSpan StartSpan StopMapViewer
1Apple-FjxPL-F1-2013LG16N/AN/A9--View
Sequences
The following sequences are available for this feature:

QTL from alignment at Chr16:3856478..3856578

Legend: genetic_marker
Hold the cursor over a type above to highlight its positions in the sequence below.
>qFB.FjxPL-LG16.T0a ID=qFB.FjxPL-LG16.T0a; Name=fruit flesh browning rate; organism=Malus x domestica; type=QTL; length=101bp; location=Sequence derived from: Chr16:3856478..3856578 (Malus x domestica
AGTTGATGCTGGTAACGGATGTCGGGCCAACCTGAATTTGGACTTGTCGG TTGCCAATGTCGCGACCTGGCTCGATGGGTGCCCGGATGGGTCCGTGGTT T
back to top