flesh browning rate, qFB.FjxPL-LG10.T60-T0%L (QTL) Malus x domestica

QTL Overview
QTL LabelqFB.FjxPL-LG10.T60-T0%L
Published SymbolL_T60-T0%-LG10
Trait Namefruit flesh browning rate
Trait AliasN/A
Trait StudyApple-Flesh_browning-Guardo-2013
PopulationFuji_x_Pink Lady
Female ParentFuji
Male ParentPink Lady
Colocalizing MarkerGDsnp02183
Neighboring MarkerN/A
EnvironmentN/A
LOD3.93
Additivity Dominance RatioN/A
R232
CommentsN/A
Alignments
The following features are aligned
Feature Name Type LocationAnalysisReference
Chr10chromosomeChr10:26300713..26300813 .Malus x domestica GDDH13 v1.1 Whole Genome Assembly & AnnotationGDR QTL alignment to genome using associated markers
Map Positions
#Map NameLinkage GroupBinChromosomePeakSpan StartSpan StopMapViewer
1Apple-FjxPL-F1-2013LG10N/AN/A46--View
Sequences
The following sequences are available for this feature:

QTL from alignment at Chr10:26300713..26300813

Legend: genetic_marker
Hold the cursor over a type above to highlight its positions in the sequence below.
>qFB.FjxPL-LG10.T60-T0%L ID=qFB.FjxPL-LG10.T60-T0%L; Name=fruit flesh browning rate; organism=Malus x domestica; type=QTL; length=101bp; location=Sequence derived from: Chr10:26300713..26300813 (Malus x domestica
TTCTGTTTCGAGTTGATTTGTGTTTTGGATTCGATATTAAACGATGAATC ACGTACTCAACTGGAAGATGGAGTTTGTCATACTTCTGTTTACGCTATAT T
back to top