BPC1, BPC1 (gene) Malus baccata

Gene Overview
Name BPC1
Gene Symbol BPC1
Type gene
Organism Malus baccata
Synonym basic pentacysteine 1 protein
Description NA
Comment similar to Arabidopsis BPC1
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
BPC1KP657685.1-BPC1.m1Malus baccatamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
Basic PentacysteinBPCMalus baccatagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly KP657685.1-BPC1.m1 Chr16:985696..986532
KP657685.1

Sequence(s):
>KP657685.1-BPC1.m1843
atggatgatgatgcattgaacatgcgcaattggggttactatgagccatcttttaaaggtcatcttagcctgcagctcat
gtcaagcatggcagagcgcgacattaaaccttttgcccctgggcgcgatcctgcagtcatggttagcgccaacggagctt
atcaccctcgggattgtgttgtatcagacgctcagcttccaatgaactatatgagggagagttgggtaaaccagcgagat
aaatttctcaatatgatgcctgccaatcctaactatgctgctgttcttccggaaacttcaggagctcattccttgcagat
cttacagccaccggaagcgtcaagggatgagcgggtgggtaggatggaagagccagttgtccctaaggaaggtggcacct
caaagaaaagacagggtgggggtgcaccaaaagccccaaaagcgaaaaggcccaggaagccaaaggataatgccaatcct
tcagttcctcgtgtgaagccagcaaagaagagtttggacgttgtgataaatgggattaatatggatatctctggtattcc
aattcccgtctgctcgtgcactggagctgcacaacagtgttataggtgggggtgtggtggttggcaatctgcttgttgca
ccacaaatgtatctatgtatcctctgccaatgagtaccaagcgacgcggggcaagaatagctggaagaaaaatgagtcag
ggtgctttcaagaaggtgctggagaagcttgcagctgaaggttataattttgctaacccaattgatctaaggtctcactg
ggcaaaacatggtaccaacaagttcgtcactctcagaaactga
back to top