COB, COB (gene) Fragaria iinumae

Gene Overview
Name COB
Gene Symbol COB
Type gene
Organism Fragaria iinumae
Synonym cytochrome b
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
COBKP824839.1-COBFragaria iinumaegene
COBKC825235.1-COBFragaria iinumaegene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
COBKP824839.1-COB.m1Fragaria iinumaemRNA
COBKC825235.1-COB.m1Fragaria iinumaemRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cytochrome bCOBFragaria iinumaegene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KP824839.1-COB N/A KP824839.1
gene parsed from NCBI nr database KC825235.1-COB N/A KC825235.1
mRNA parsed from NCBI nr database KP824839.1-COB.m1 N/A KP824839.1
mRNA parsed from NCBI nr database KC825235.1-COB.m1 N/A KC825235.1

Sequence(s):
>KP824839.1-COB1299
atggtccaactacataactttttctttttcattacttccatggtcgtgccttgtggcacggcagcacccgtactattgaa
atggtttgtcagtagagatgttcccacaggtgcccctttttccaatggtactataattcctattcctatccctgcattcc
ctcttttgatctatatacattccaggaaattcatacgctccatggacggagcaaaaagtggagtcttggtcagagcaagc
cgccctattttattaccagacataattgagagaagctcagcagctagaaacgccttatttcgtttcgttcccgttcttca
tttccttcttctcgcatacaagggggacttatcatatttagaatctctctgcggtgtgctctgtttactattctttcgta
ctctcttctctttaccacgcgataggtcgtcagcgaagcgtgagcgggcgcggagaaggaaacgccaaacacttcggcct
aacgggaatgagcaacgacgaaatgacaagatgaggtgctccgggcacccccgaagggtcgaaggttttgggcctgtagc
tttccccgcccccccttcgtcggatggtgcttgtggggggcgtgtgccaccagaaatagggcttgaagctctcgccttac
caacgagccgacagctgatggctgttggtcacgactactaccaaaaagctccaatgaagatgaatatttcacatggagga
gtgtgcatctgtatgttgggtgttcttctgtctaacacaaagaagatacagttcactcaacgattgcctttgggttccga
actccttatggggaaggagcgttgttgtttgcgaggtctcgatcatttacatggacccacttctcattccatttgtggaa
atttgatgatctataaaccgtccctaacgaacgatcggctcatgtttgagcatgatgaatcactgcgtgccgacgtgttg
ccaataagctttccggcctcatatgagaatggaaaactggagcattttctgcatcggtggatgaagaatcgcgaacataa
taatttctggttgaccatgttcccagaaaaaagatactttcgagaaacgacgagcacgaccgaagtggctatacatacaa
atctatttacggatctatatgcttcgattggaactggaagttccagaacaggcggctggtataccaccataatgaaactg
ccttttattttttttattcggataggatttatgttggcttcgtcgggaggctcgcgtagtttgttacgtcagctccaaaa
ggataagttgcgttggaat
back to top
>KC825235.1-COB1167
atgactataaggaaccaacgattctctcttcttaaacaacctatatcctccacactaaatcaacatttgatagattatcc
aaccccgagcaatcttagttattggtgggggttcggtccgttagctggtatttgtttagtcattcagatagtgactggcg
tttttttagctatgcattacacacctcatgtggatctagctttcaacagcgtagaacacattatgagagatgttgaaggg
ggttggttgctccgttatatgcatgctaatggggcaagtatgtttctcattgtggttcaccttcatatttttcgcggtct
atatcatgcgagttatagcagtcctagggaatttgtttggtgtctcggagttgtaatcttcctattaatgattgtgacag
cttttacaggatacgtactaccttggggtcagatgagcttttggggagctacagtaattacaagcttagctagcgccata
cctgtagtaggggataccatagtgacttggctttggggcggtttctccgtggacaatgccaccttaaatcgtttttttag
tcttcatcatttactcccctttattttagtaggcgccagtcttcttcatctggccgcattgcatcaatatggatccaata
atccattgggtgtacattcagagatggataaaatttctttttacccttatttttatgtaaaggatctagtaggttgggta
gcttttgctatctttttttccatttggattttttatgctcctaatgttttggggcatcccgacaattatatacctgctaa
tccgatgcccaccccgcctcatattgtgccggaatggtatttcctaccgatccatgccattcttcgtagtatacctgaca
aagcgggaggtgtagccgcaatagcaccagtttttatatgtctgttggctttacctttttttaaaagtatgtatgtgcgt
agttcaagttttcgccctattcaccaagcaatattttggttgcttttggcggattgcgtactactaggttggatcggatg
tcaacctgtggaggcaccatttgttactattggacaaatttctcctttagttttcttcttattctttgccataacgccca
tttcgggaaaagttggaagaggaattcctaattcttacacggatgag
back to top
>KP824839.1-COB.m11299
atggtccaactacataactttttctttttcattacttccatggtcgtgccttgtggcacggcagcacccgtactattgaa
atggtttgtcagtagagatgttcccacaggtgcccctttttccaatggtactataattcctattcctatccctgcattcc
ctcttttgatctatatacattccaggaaattcatacgctccatggacggagcaaaaagtggagtcttggtcagagcaagc
cgccctattttattaccagacataattgagagaagctcagcagctagaaacgccttatttcgtttcgttcccgttcttca
tttccttcttctcgcatacaagggggacttatcatatttagaatctctctgcggtgtgctctgtttactattctttcgta
ctctcttctctttaccacgcgataggtcgtcagcgaagcgtgagcgggcgcggagaaggaaacgccaaacacttcggcct
aacgggaatgagcaacgacgaaatgacaagatgaggtgctccgggcacccccgaagggtcgaaggttttgggcctgtagc
tttccccgcccccccttcgtcggatggtgcttgtggggggcgtgtgccaccagaaatagggcttgaagctctcgccttac
caacgagccgacagctgatggctgttggtcacgactactaccaaaaagctccaatgaagatgaatatttcacatggagga
gtgtgcatctgtatgttgggtgttcttctgtctaacacaaagaagatacagttcactcaacgattgcctttgggttccga
actccttatggggaaggagcgttgttgtttgcgaggtctcgatcatttacatggacccacttctcattccatttgtggaa
atttgatgatctataaaccgtccctaacgaacgatcggctcatgtttgagcatgatgaatcactgcgtgccgacgtgttg
ccaataagctttccggcctcatatgagaatggaaaactggagcattttctgcatcggtggatgaagaatcgcgaacataa
taatttctggttgaccatgttcccagaaaaaagatactttcgagaaacgacgagcacgaccgaagtggctatacatacaa
atctatttacggatctatatgcttcgattggaactggaagttccagaacaggcggctggtataccaccataatgaaactg
ccttttattttttttattcggataggatttatgttggcttcgtcgggaggctcgcgtagtttgttacgtcagctccaaaa
ggataagttgcgttggaat
back to top
>KC825235.1-COB.m11167
atgactataaggaaccaacgattctctcttcttaaacaacctatatcctccacactaaatcaacatttgatagattatcc
aaccccgagcaatcttagttattggtgggggttcggtccgttagctggtatttgtttagtcattcagatagtgactggcg
tttttttagctatgcattacacacctcatgtggatctagctttcaacagcgtagaacacattatgagagatgttgaaggg
ggttggttgctccgttatatgcatgctaatggggcaagtatgtttctcattgtggttcaccttcatatttttcgcggtct
atatcatgcgagttatagcagtcctagggaatttgtttggtgtctcggagttgtaatcttcctattaatgattgtgacag
cttttacaggatacgtactaccttggggtcagatgagcttttggggagctacagtaattacaagcttagctagcgccata
cctgtagtaggggataccatagtgacttggctttggggcggtttctccgtggacaatgccaccttaaatcgtttttttag
tcttcatcatttactcccctttattttagtaggcgccagtcttcttcatctggccgcattgcatcaatatggatccaata
atccattgggtgtacattcagagatggataaaatttctttttacccttatttttatgtaaaggatctagtaggttgggta
gcttttgctatctttttttccatttggattttttatgctcctaatgttttggggcatcccgacaattatatacctgctaa
tccgatgcccaccccgcctcatattgtgccggaatggtatttcctaccgatccatgccattcttcgtagtatacctgaca
aagcgggaggtgtagccgcaatagcaccagtttttatatgtctgttggctttacctttttttaaaagtatgtatgtgcgt
agttcaagttttcgccctattcaccaagcaatattttggttgcttttggcggattgcgtactactaggttggatcggatg
tcaacctgtggaggcaccatttgttactattggacaaatttctcctttagttttcttcttattctttgccataacgccca
tttcgggaaaagttggaagaggaattcctaattcttacacggatgag
back to top