COB, COB (gene) Fragaria vesca subsp. bracteata

Gene Overview
Name COB
Gene Symbol COB
Type gene
Organism Fragaria vesca subsp. bracteata
Synonym cytochrome b
cytochrome B
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
COBKP824840.1-COBFragaria vesca subsp. bracteatagene
COBKP824838.1-COBFragaria vesca subsp. bracteatagene
COBKC825242.1-COBFragaria vesca subsp. bracteatagene
COBKC825241.1-COBFragaria vesca subsp. bracteatagene
COBKC825237.1-COBFragaria vesca subsp. bracteatagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
COBKP824840.1-COB.m1Fragaria vesca subsp. bracteatamRNA
COBKP824838.1-COB.m1Fragaria vesca subsp. bracteatamRNA
COBKC825242.1-COB.m1Fragaria vesca subsp. bracteatamRNA
COBKC825241.1-COB.m1Fragaria vesca subsp. bracteatamRNA
COBKC825237.1-COB.m1Fragaria vesca subsp. bracteatamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cytochrome bCOBFragaria vesca subsp. bracteatagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KP824840.1-COB N/A KP824840.1
gene parsed from NCBI nr database KP824838.1-COB N/A KP824838.1
gene parsed from NCBI nr database KC825242.1-COB N/A KC825242.1
gene parsed from NCBI nr database KC825241.1-COB N/A KC825241.1
gene parsed from NCBI nr database KC825237.1-COB N/A KC825237.1
mRNA parsed from NCBI nr database KP824840.1-COB.m1 N/A KP824840.1
mRNA parsed from NCBI nr database KP824838.1-COB.m1 N/A KP824838.1
mRNA parsed from NCBI nr database KC825242.1-COB.m1 N/A KC825242.1
mRNA parsed from NCBI nr database KC825241.1-COB.m1 N/A KC825241.1
mRNA parsed from NCBI nr database KC825237.1-COB.m1 N/A KC825237.1

Sequence(s):
>KP824840.1-COB1308
atggtccaactacataactttttctttttcattacttccatggtcgtgccttgtggcacggcagcacccgtactattgaa
atggtttgtcagtagagatgttcccacaggtgcccctttttccaatggtactataattcctattcctatccctgcattcc
ctcttttgatctatatacattccaggaaattcatacgctccatggacggagcaaaaagtggagtcttggtcagagcaagc
cgccctattttattaccagacataattgagagaagctcagccgaaattagagctagaaacgccttatttcgtttcgttcc
cgttcttcatttccttcttctcgcatacaagggggacttatcatatttagaatctctctgcggtgtgctctgtttactat
tctttcgtactctcttctctttaccacgcgataggtcgtcagcgaagcgtgagcgggcgcggagaaggaaacgccaaaca
cttcggcctaacgggaatgagcaacgacgaaatgacaagatgaggtgctccgggcacccccgaagggtcgaaggttttgg
gcctgtagctttccccgcccccccttcgtcggatggtgcttgtggggggcgtgtgccaccagaaatagggcttgaagctc
tcgccttaccaacgagccgacagctgatggctgttggtcacgactactaccaaaaagctccaatgaagatgaatatttca
catggaggagtgtgcatctgtatgttgggtgttcttctgtctaacacaaagaagatacagttcactcaacgattgccttt
gggttccgaactccttatggggaaggagcgttgttgtttgcgaggtctcgatcatttacatggacccacttctcattcca
tttgtggaaatttgatgatctataaaccgtccctaacgaacgatcggctcatgtttgagcatgatgaatcactgcgtgcc
gacgtgttgccaataagctttccggcctcatatgagaatggaaaactggagcattttctgcatcggtggatgaagaatcg
cgaacataataatttctggttgaccatgttcccagaaaaaagatactttcgagaaacgacgagcacgaccgaagtggcta
tacatacaaatctatttacggatctatatgcttcgattggaactggaagttccagaacaggcggctggtataccaccata
atgaaactgccttttattttttttattcggataggatttatgttggcttcgtcgggaggctcgcgtagtttgttacgtca
gctccaaaaggataagttgcgttggaat
back to top
>KP824838.1-COB1308
atggtccaactacataactttttctttttcattacttccatggtcgtgccttgtggcacggcagcacccgtactattgaa
atggtttgtcagtagagatgttcccacaggtgcccctttttccaatggtactataattcctattcctatccctgcattcc
ctcttttgatctatatacattccaggaaattcatacgctccatggacggagcaaaaagtggagtcttggtcagagcaagc
cgccctattttattaccagacataattgagagaagctcagccgaaattagagctagaaacgccttatttcgtttcgttcc
cgttcttcatttccttcttctcgcatacaagggggacttatcatatttagaatctctctgcggtgtgctctgtttactat
tctttcgtactctcttctctttaccacgcgataggtcgtcagcgaagcgtgagcgggcgcggagaaggaaacgccaaaca
cttcggcctaacgggaatgagcaacgacgaaatgacaagatgaggtgctccgggcacccccgaagggtcgaaggttttgg
gcctgtagctttccccgcccccccttcgtcggatggtgcttgtggggggcgtgtgccaccagaaatagggcttgaagctc
tcgccttaccaacgagccgacagctgatggctgttggtcacgactactaccaaaaagctccaatgaagatgaatatttca
catggaggagtgtgcatctgtatgttgggtgttcttctgtctaacacaaagaagatacagttcactcaacgattgccttt
gggttccgaactccttatggggaaggagcgttgttgtttgcgaggtctcgatcatttacatggacccacttctcattcca
tttgtggaaatttgatgatctataaaccgtccctaacgaacgatcggctcatgtttgagcatgatgaatcactgcgtgcc
gacgtgttgccaataagctttccggcctcatatgagaatggaaaactggagcattttctgcatcggtggatgaagaatcg
cgaacataataatttctggttgaccatgttcccagaaaaaagatactttcgagaaacgacgagcacgaccgaagtggcta
tacatacaaatctatttacggatctatatgcttcgattggaactggaagttccagaacaggcggctggtataccaccata
atgaaactgccttttattttttttattcggataggatttatgttggcttcgtcgggaggctcgcgtagtttgttacgtca
gctccaaaaggataagttgcgttggaat
back to top
>KC825242.1-COB1179
atgactataaggaaccaacgattctctcttcttaaacaacctatatcctccacactaaatcancatttgatagattatcc
aaccccgagcaatcttagttattggtgggggttcggtgcgttagctggtctttgtttagtcattcagatagtgactggcg
tttttttagctatgcattacacacctcatgtggatctagctttcaacagcgtagaacacattatgagagatgttgaaggg
ggttggttgctccgttatatgcatgctaatggggcaagtatgtttctcattgtggttcaccttcatatttttcgcggtct
atatcatgcgagttatagcagtcctagggaatttgtttggtgtctcggagttgtaatcttcctattaatgattgtgacag
cttttacaggatacgtactaccttggggtcagatgagcttttggggagctacagtaattacaagcttagctagcgccata
cctgtagtaggggataccatagtgacttggctttggggcggtttctccgtggacaatgccaccttaaatcgtttttttag
tcttcatcatttactcccctttattttagtaggcgccagtcttcttcatctggccgcattgcatcaatatggatccaata
atccattgggtgtacattcagagatggataaaatttctttttacccttatttttatgtaaaggatctagtaggttgggta
gcttttgctatctttttttccatttggattttttatgctcctaatgttttggggcatcccgacaattatatacctgctaa
tccgatgcccaccccgcctcatattgtgccggaatggtatttcctaccgatccatgccattcttcgtagtatacctgaca
aagcgggaggtgtagccgcaatagcaccagtttttatatgtctgttggctttacctttttttaaaagtatgtatgtgcgt
agttcaagttttcgccctattcaccaagcaatattttggttgcttttggcggattgcgtactactaggttggatcggatg
tcaacctgtggaggcaccatttgttactattggacaaatttctcctttagttttcttcttattctttgccataacgccca
tttcgggaaaagttggaagaggaattcctaattcttacacggatgagactgatcacacc
back to top
>KC825241.1-COB1136
tatcctccacactaaatcancatttgatagattatccaaccccnagcaatcttagttattggtgggggttcggtgngtta
gctggtctttgtttagtcattcagatagtgactggcgtttttttagctatgcattacacacctcatgtggatctagcttt
caacagcgtagaacacattatgagagatgttgaagggggttggttgctccgttatatgcatgctaatggggcaagtatgt
ttctcattgtggttcaccttcatatttttcgcggtctatatcatgcgagttatagcagtcctagggaatttgtttggtgt
ctcggagttgtaatcttcctattaatgattgtgacagcttttanaggatacgtactaccttggggtcagatgagcttttg
gggagctacagtaattacaagcttagctagcgccatacctgtagtaggggataccatagtgacttggctttggggcggtt
tctccgtggacaatgccaccttaaatcgtttttttagtcttcatcatttactcccctttattttagtaggcgccagtctt
cttcatctggccgcattgcatcaatatggatccaataatccattgggtgtacattcagagatggataaaatttcttttta
cccttatttttatgtaaaggatctagtaggttgggtagcttttgctatctttttttccatttggattttttatgctccta
atgttttggggcatcccgacaattatatacctgctaatccgatgcccaccccgcctcatattgtgccggaatggtatttc
ctaccgatccatgccattcttcgtagtatacctgacaaagcgggaggtgtagccgcaatagcaccagtttttatatgtct
gttggctttacctttttttaaaagtatgtatgtgcgtagttcaagttttcgccctattcaccaagcaatattttggttgc
ttttggcggattgcgtactactaggttggatcggatgtcaacctgtggaggcaccatttgttactattggacaaatttct
cctttagttttcttcttattctttgccataacgcccatttcgggaaaagttggaagaggaattcctaattcttacacgga
tgagactgatcacacc
back to top
>KC825237.1-COB1167
atgactataaggaaccaacgattctctcttcttaaacaacctatatcctccacactaaatcaacatttgatagattatcc
aaccccnagcaatcttagttattggtgggggttcggtgngttagctggtctttgtttagtcattcagatagtgactggcg
tttttttagctatgcattacacacctcatgtggatctagctttcaacagcgtagaacacattatgagagatgttgaaggg
ggttggttgctccgttatatgcatgctaatggggcaagtatgtttctcattgtggttcaccttcatatttttcgcggtct
atatcatgcgagttatagcagtcctagggaatttgtttggtgtctcggagttgtaatcttcctattaatgattgtgacag
cttttanaggatacgtactaccttggggtcagatgagcttttggggagctacagtaattacaagcttagctagcgccata
cctgtagtaggggataccatagtgacttggctttggggcggtttctccgtggacaatgccaccttaaatcgtttttttag
tcttcatcatttactcccctttattttagtaggcgccagtcttcttcatctggccgcattgcatcaatatggatccaata
atccattgggtgtacattcagagatggataaaatttctttttacccttatttttatgtaaaggatctagtaggttgggta
gcttttgctatctttttttccatttggattttttatgctcctaatgttttggggcatcccgacaattatatacctgctaa
tccgatgcccaccccgcctcatattgtgccggaatggtatttcctaccgatccatgccattcttcgtagtatacctgaca
aagcgggaggtgtagccgcaatagcaccagtttttatatgtctgttggctttacctttttttaaaagtatgtatgtgcgt
agttcaagttttcgccctattcaccaagcaatattttggttgcttttggcggattgcgtactactaggttggatcggatg
tcaacctgtggaggcaccatttgttactattggacaaatttctcctttagttttcttcttattctttgccataacgccca
tttcgggaaaagttggaagaggaattcctaattcttacacggatgag
back to top
>KP824840.1-COB.m11308
atggtccaactacataactttttctttttcattacttccatggtcgtgccttgtggcacggcagcacccgtactattgaa
atggtttgtcagtagagatgttcccacaggtgcccctttttccaatggtactataattcctattcctatccctgcattcc
ctcttttgatctatatacattccaggaaattcatacgctccatggacggagcaaaaagtggagtcttggtcagagcaagc
cgccctattttattaccagacataattgagagaagctcagccgaaattagagctagaaacgccttatttcgtttcgttcc
cgttcttcatttccttcttctcgcatacaagggggacttatcatatttagaatctctctgcggtgtgctctgtttactat
tctttcgtactctcttctctttaccacgcgataggtcgtcagcgaagcgtgagcgggcgcggagaaggaaacgccaaaca
cttcggcctaacgggaatgagcaacgacgaaatgacaagatgaggtgctccgggcacccccgaagggtcgaaggttttgg
gcctgtagctttccccgcccccccttcgtcggatggtgcttgtggggggcgtgtgccaccagaaatagggcttgaagctc
tcgccttaccaacgagccgacagctgatggctgttggtcacgactactaccaaaaagctccaatgaagatgaatatttca
catggaggagtgtgcatctgtatgttgggtgttcttctgtctaacacaaagaagatacagttcactcaacgattgccttt
gggttccgaactccttatggggaaggagcgttgttgtttgcgaggtctcgatcatttacatggacccacttctcattcca
tttgtggaaatttgatgatctataaaccgtccctaacgaacgatcggctcatgtttgagcatgatgaatcactgcgtgcc
gacgtgttgccaataagctttccggcctcatatgagaatggaaaactggagcattttctgcatcggtggatgaagaatcg
cgaacataataatttctggttgaccatgttcccagaaaaaagatactttcgagaaacgacgagcacgaccgaagtggcta
tacatacaaatctatttacggatctatatgcttcgattggaactggaagttccagaacaggcggctggtataccaccata
atgaaactgccttttattttttttattcggataggatttatgttggcttcgtcgggaggctcgcgtagtttgttacgtca
gctccaaaaggataagttgcgttggaat
back to top
>KP824838.1-COB.m11308
atggtccaactacataactttttctttttcattacttccatggtcgtgccttgtggcacggcagcacccgtactattgaa
atggtttgtcagtagagatgttcccacaggtgcccctttttccaatggtactataattcctattcctatccctgcattcc
ctcttttgatctatatacattccaggaaattcatacgctccatggacggagcaaaaagtggagtcttggtcagagcaagc
cgccctattttattaccagacataattgagagaagctcagccgaaattagagctagaaacgccttatttcgtttcgttcc
cgttcttcatttccttcttctcgcatacaagggggacttatcatatttagaatctctctgcggtgtgctctgtttactat
tctttcgtactctcttctctttaccacgcgataggtcgtcagcgaagcgtgagcgggcgcggagaaggaaacgccaaaca
cttcggcctaacgggaatgagcaacgacgaaatgacaagatgaggtgctccgggcacccccgaagggtcgaaggttttgg
gcctgtagctttccccgcccccccttcgtcggatggtgcttgtggggggcgtgtgccaccagaaatagggcttgaagctc
tcgccttaccaacgagccgacagctgatggctgttggtcacgactactaccaaaaagctccaatgaagatgaatatttca
catggaggagtgtgcatctgtatgttgggtgttcttctgtctaacacaaagaagatacagttcactcaacgattgccttt
gggttccgaactccttatggggaaggagcgttgttgtttgcgaggtctcgatcatttacatggacccacttctcattcca
tttgtggaaatttgatgatctataaaccgtccctaacgaacgatcggctcatgtttgagcatgatgaatcactgcgtgcc
gacgtgttgccaataagctttccggcctcatatgagaatggaaaactggagcattttctgcatcggtggatgaagaatcg
cgaacataataatttctggttgaccatgttcccagaaaaaagatactttcgagaaacgacgagcacgaccgaagtggcta
tacatacaaatctatttacggatctatatgcttcgattggaactggaagttccagaacaggcggctggtataccaccata
atgaaactgccttttattttttttattcggataggatttatgttggcttcgtcgggaggctcgcgtagtttgttacgtca
gctccaaaaggataagttgcgttggaat
back to top
>KC825242.1-COB.m11179
atgactataaggaaccaacgattctctcttcttaaacaacctatatcctccacactaaatcancatttgatagattatcc
aaccccgagcaatcttagttattggtgggggttcggtgcgttagctggtctttgtttagtcattcagatagtgactggcg
tttttttagctatgcattacacacctcatgtggatctagctttcaacagcgtagaacacattatgagagatgttgaaggg
ggttggttgctccgttatatgcatgctaatggggcaagtatgtttctcattgtggttcaccttcatatttttcgcggtct
atatcatgcgagttatagcagtcctagggaatttgtttggtgtctcggagttgtaatcttcctattaatgattgtgacag
cttttacaggatacgtactaccttggggtcagatgagcttttggggagctacagtaattacaagcttagctagcgccata
cctgtagtaggggataccatagtgacttggctttggggcggtttctccgtggacaatgccaccttaaatcgtttttttag
tcttcatcatttactcccctttattttagtaggcgccagtcttcttcatctggccgcattgcatcaatatggatccaata
atccattgggtgtacattcagagatggataaaatttctttttacccttatttttatgtaaaggatctagtaggttgggta
gcttttgctatctttttttccatttggattttttatgctcctaatgttttggggcatcccgacaattatatacctgctaa
tccgatgcccaccccgcctcatattgtgccggaatggtatttcctaccgatccatgccattcttcgtagtatacctgaca
aagcgggaggtgtagccgcaatagcaccagtttttatatgtctgttggctttacctttttttaaaagtatgtatgtgcgt
agttcaagttttcgccctattcaccaagcaatattttggttgcttttggcggattgcgtactactaggttggatcggatg
tcaacctgtggaggcaccatttgttactattggacaaatttctcctttagttttcttcttattctttgccataacgccca
tttcgggaaaagttggaagaggaattcctaattcttacacggatgagactgatcacacc
back to top
>KC825241.1-COB.m11136
tatcctccacactaaatcancatttgatagattatccaaccccnagcaatcttagttattggtgggggttcggtgngtta
gctggtctttgtttagtcattcagatagtgactggcgtttttttagctatgcattacacacctcatgtggatctagcttt
caacagcgtagaacacattatgagagatgttgaagggggttggttgctccgttatatgcatgctaatggggcaagtatgt
ttctcattgtggttcaccttcatatttttcgcggtctatatcatgcgagttatagcagtcctagggaatttgtttggtgt
ctcggagttgtaatcttcctattaatgattgtgacagcttttanaggatacgtactaccttggggtcagatgagcttttg
gggagctacagtaattacaagcttagctagcgccatacctgtagtaggggataccatagtgacttggctttggggcggtt
tctccgtggacaatgccaccttaaatcgtttttttagtcttcatcatttactcccctttattttagtaggcgccagtctt
cttcatctggccgcattgcatcaatatggatccaataatccattgggtgtacattcagagatggataaaatttcttttta
cccttatttttatgtaaaggatctagtaggttgggtagcttttgctatctttttttccatttggattttttatgctccta
atgttttggggcatcccgacaattatatacctgctaatccgatgcccaccccgcctcatattgtgccggaatggtatttc
ctaccgatccatgccattcttcgtagtatacctgacaaagcgggaggtgtagccgcaatagcaccagtttttatatgtct
gttggctttacctttttttaaaagtatgtatgtgcgtagttcaagttttcgccctattcaccaagcaatattttggttgc
ttttggcggattgcgtactactaggttggatcggatgtcaacctgtggaggcaccatttgttactattggacaaatttct
cctttagttttcttcttattctttgccataacgcccatttcgggaaaagttggaagaggaattcctaattcttacacgga
tgagactgatcacacc
back to top
>KC825237.1-COB.m11167
atgactataaggaaccaacgattctctcttcttaaacaacctatatcctccacactaaatcaacatttgatagattatcc
aaccccnagcaatcttagttattggtgggggttcggtgngttagctggtctttgtttagtcattcagatagtgactggcg
tttttttagctatgcattacacacctcatgtggatctagctttcaacagcgtagaacacattatgagagatgttgaaggg
ggttggttgctccgttatatgcatgctaatggggcaagtatgtttctcattgtggttcaccttcatatttttcgcggtct
atatcatgcgagttatagcagtcctagggaatttgtttggtgtctcggagttgtaatcttcctattaatgattgtgacag
cttttanaggatacgtactaccttggggtcagatgagcttttggggagctacagtaattacaagcttagctagcgccata
cctgtagtaggggataccatagtgacttggctttggggcggtttctccgtggacaatgccaccttaaatcgtttttttag
tcttcatcatttactcccctttattttagtaggcgccagtcttcttcatctggccgcattgcatcaatatggatccaata
atccattgggtgtacattcagagatggataaaatttctttttacccttatttttatgtaaaggatctagtaggttgggta
gcttttgctatctttttttccatttggattttttatgctcctaatgttttggggcatcccgacaattatatacctgctaa
tccgatgcccaccccgcctcatattgtgccggaatggtatttcctaccgatccatgccattcttcgtagtatacctgaca
aagcgggaggtgtagccgcaatagcaccagtttttatatgtctgttggctttacctttttttaaaagtatgtatgtgcgt
agttcaagttttcgccctattcaccaagcaatattttggttgcttttggcggattgcgtactactaggttggatcggatg
tcaacctgtggaggcaccatttgttactattggacaaatttctcctttagttttcttcttattctttgccataacgccca
tttcgggaaaagttggaagaggaattcctaattcttacacggatgag
back to top