COB, COB (gene) Prunus virginiana

Gene Overview
Name COB
Gene Symbol COB
Type gene
Organism Prunus virginiana
Synonym cytochrome b
CYB
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
COBKT458949.1-COB.m1Prunus virginianamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cytochrome bCOBPrunus virginianagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KT458949.1-COB.m1 N/A KT458949.1

Sequence(s):
>KT458949.1-COB.m11182
atgactataaggaaccaacgattctctcttcttaaacaaccaatatcctccacacttaatcagcatttgatagattatcc
aaccccgagcaatcttagttattggtgggggttcggtccgttagctggtatttgtttagtcattcagatagtgactggcg
tttttttagctatgcatcacacacctcatgtggatctagctttcaacagcgtagaacacattatgagagatgttgaaggg
ggttggttgctccgttatatgcatgctaatggggcaagtatgtttctcattgtggttcaccttcatatttttcgcggtct
atatcatgcgagttatagcagtcctagggaatttgttcggtgtctcggagttgtaatcttcctattaatgattgtgacag
cttttacaggatacgtactaccttggggtcagatgagcttttggggagctacagtaattacaagcttagctagcgccata
cctgtagtaggggataccatagttacttggctttggggcggtttctccgtggacaatgccaccttaaatcgtttttttag
tcttcatcatttactcccctttattttagtaggcgccagtcttcttcatctggccgcattgcatcaatatggatcaaata
atccattgggtgtacattcagagatggataaaatttctttttacccttatttttatgtaaaggatctagtaggttgggta
gcttttgctatcttttcttccatttggattttttatgctcctaatgttttggggcatcccgacaattatatacctgctaa
tccgatgcccaccccgcctcatattgtgccggaatggtatttcctaccgatccatgccattcttcgtagtatacctgaca
aatcgggaggtgtagccgcaatagcaccagtttttatatgtctgttggctttacctttttttaaaagtatgtatgtgcgt
agttcaagttttcgccctattcaccaaggaatattttggttgcttttggcggattgcttactactaggttggatcggatg
tcaacctgtggaggcaccatttgttactattggacaaatttctcctttagttttcttcttattctttgccataacgccca
ttccgggacaggttggaagaggaattcctaattcttacacggatgagactgatcacacctga
back to top