ADC, ADC (gene) Malus x domestica

Gene Overview
Name ADC
Gene Symbol ADC
Type gene
Organism Malus x domestica
Synonym arginine decarboxylase
MdADC
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
arginine decarboxylaseADCMalus x domesticagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ADCAB181854.1-ADC.m1Malus x domesticamRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly AB181854.1-ADC.m1 Chr05:9464564..9466751
unanchored:7183816..7186003
AB181854.1

Sequence(s):
>AB181854.1-ADC.m12187
atgccggccctggcttgttgcgtggatgctgctgtggcgcctcccggccacgctttcgccggggatagctctcttcccgc
gtcgccgttcccaggcttacctccggcgaccatcaccaccgccgccgacaattcccattggtccccttccctctcgtccg
acctctaccgaatagacgcctggggtgggccctacttcaccgtcaactcctccggcaacgtcgccgtccgtcctcatggg
acggcgactctgcctcaccaggagattgatctgctgaagatcgtgaagaaggtttcggattcaaaaccggagtgcggact
tgggttgcagctgccgctcattgttcgcctccctgatgtgctcaaggaccggctcgagtccctccagggcgccttcgatc
tggcgatccggtcccacgactacggctcccactaccagggcgtgtacccggtgaaatgcaaccaggaccggttcgtcgtg
gaggacattgtcaagttcgggtccccgttccggttcggactggaagccgggtcgaagccggagctcctcttggccatgag
ctgcttgtgcaaaggtcatcccgacgcccttctcatctgcaatggattcaaagaccttgagtacatctctctggctctgt
tcgcccgcaagctcgccttgaacactgtgattgttcttgagcaagaggaggagctcgatttggttgttgatttcagccaa
aagctcggcgtacgacccgtgattggcgtccgggccaagctcaagaccaagcattcgggccatttcggttcgacttccgg
cgaggagggaaagttcggactcaccaccactcagattttacgcgttgtgaagaagcttgataagctgggtatgcttgatt
gctttcagttgttgcattttcataccgggtctcagatcccttcgacggccctgctcgctgatggcgtatccgaggcatcg
cagatatattgcgaattggtccgtctcggtgcccacatgaaggtcatagacattggaggcggtctgggtattgattacga
tggatccaaatctagtgactcggagatttcggtcagctacggccttgaagagtatgcctccgccgttgtccgaacggttc
ggaacgtctgtgaacggaggtccgtgaagcacccggtgatttgcagtgaaagcggccgagccttggtttcccaccactcg
gttctcatatttgaggctatttcttccagtgcttgtgatgatgctcctcccatgtccgcctttgagcatcagtacttcat
tgagggtctgacggatgaagctcgtgccgattacctgaacctctccgctgcggctatcagaggtgagtacgaggcttgtt
tgacgtatgctgatctgttgaaacaacggagtgttgaacaattcaaagaagggtctgtcggtattgagcaattggccacc
gtcgatgggttctgtgatatgttttcgaaagcaatcggggcatctgacgctgtccgtacataccatgtgaatctctcggt
attcacttcaattccagacttctggggtattgggcagacgttccccatagtcccgattcaccgcctcgatcaatggcctg
cagtgaggggagtattgtcagacttgacctgtgacagtgatgggaaaatcgacaagttcattggcggcgggtctagcttg
ccgctgcatgagctggaaggcgatggtgggaataatggcggtgggcaaaagtactatttggggatgttcctgggcggggc
ttatcaggaggcgctcggaggagtccacaacctcttcggtggcccgagcattgttcgggtttcgcagagcgatggtcccc
acagcttcgcggtgacgggagctgtgtcaggtccgtcatgtggggacgtcctgcgggtgatgcagcatgagcccgagctc
atgtttgagacgctgaagcaccgcgcggaggagtgcgggcagggtgacgatgggggaatggccagtgccgctgtggccac
cagcctggcccggtccttccacaacatgccgtacctggtgtcagcttcttcttgtagcctgactgcaatgaataaccatg
ggttctactattgcagcgaggatgattacggcgacattgttgccgattcggcgggggctgctgctcccgttggcgaggaa
gaacagtggtcttattgctgtgcttaa
back to top