MADS-2, MADS-2 (gene) Fragaria x ananassa

Gene Overview
Name MADS-2
Gene Symbol MADS-2
Type gene
Organism Fragaria x ananassa
Synonym MADS-2
Description NA
Comment FaMADS-2
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS-2HQ602764.1-MADS-2.m1Fragaria x ananassamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSFragaria x ananassagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database HQ602764.1-MADS-2.m1 N/A HQ602764.1

Sequence(s):
>HQ602764.1-MADS-2.m1543
atgctcaaaacactggagagataccagaagtgcaactatggagcaccagagacaaatgtatctacaagggaggccttgga
attgagtagccaacaggagtatttgaagctcaaggcacgttatgatgccctacaaagaaaccaaaggaatcttcttggag
aagatcttggccctttgagcagcaaggagctcgaatcgcttgaaaggcagctggatatgtcactgaagcagatcagatca
acacggacccaatgcatgctggatcagctcacagatcttcagcaaaaggaacacttgcttaacgaggcaaacaggacact
gaaacaaaggttgttcgatggatacaatcatcaactccaactgaatgcaaatgctgaggaagtggcatatggccggcaac
aagctcatcaacctcggggcgatggcttcttccaagccttagagtgcgagcccacattacaaattgggtatcaccagaat
gatccgatacaagtcgtgacggccgggccgagcgtgaattacatgggaggatggttgccatga
back to top