MADS-1, MADS-1 (gene) Fragaria x ananassa

Gene Overview
Name MADS-1
Gene Symbol MADS-1
Type gene
Organism Fragaria x ananassa
Synonym MADS-1
Description NA
Comment FaMADS-1
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS-1HQ602763.1-MADS-1.m1Fragaria x ananassamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSFragaria x ananassagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database HQ602763.1-MADS-1.m1 LG6:32713571..32717121
HQ602763.1

Sequence(s):
>HQ602763.1-MADS-1.m1750
atggggaggggaagagtggagctgaagagaatagagaacaagataaacaggcaagtcacatttgcaaagagaagaaatgg
gctcttaaagaaagcttatgagctctctattctctgtgacgctgaggttgctctcatcatattctctaaccgtgggaagc
tctatgagttctgcagcagctccagcatgctcaaaacccttgaaaggtaccaaaaatgtagctacggtgcaatggaagtc
caaaaacctgccaaggaacttgaggagagcagctatcgtgaatatttgaagctgaaaactagatgcgagtctcttcaaca
aactcagagaaaccttcttggagaagacttagggccattaaacacgaaggagcttgagcagcttgagcgtcagctagagt
cctccttgaagcatgttaggtctactaagacccagcatatgattgatctgctttctgaccttcagagcaaggaacatatg
ctaattgaagccaacagagatttgaaaacgaagttggatgaaattgattcaagaactcaacttagacaaacttgggaaca
tggtcatgatcaccagactatgctatatggaactcaacatgctcagacacagggacttatgttccagcctttagattgca
atcccaccttgcaaatagggtacaatgctgtggtgtcacaggaaatgcctacagccacaccagcccatgctcaacccgtc
aatggtttcattcctggttggatgctctga
back to top