MADS10, MADS10 (gene) Prunus persica

Gene Overview
Name MADS10
Gene Symbol MADS10
Type gene
Organism Prunus persica
Synonym PISTILLATA-like protein
Description NA
Comment PrpMADS10; MADS box transcription factor
Evidence for the gene structure imported from NCBI
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSPrunus persicagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS10EU005663.1-MADS10.m1Prunus persicamRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database EU005663.1-MADS10.m1 scaffold_1:39773124..39775605
EU005663.1

Sequence(s):
>EU005663.1-MADS10.m1633
atggggaggggcaagattgagattaagaggattgagaactcaagcaacaggcaggtcacttactctaagagaaggaatgg
gatcattaagaaggccaaggaaatcactgttctatgtgatgctaaggtttcacttgtcatctttgctagctctggaaaga
tggttgaatactgcagcccttcagtcacggtgactgatatcttggacaagtaccatggccaggctgggaagaagttatgg
gatgcaaagcatgagaacctcagcaatgaagtggatagggtcaagaaagacaacgacagcatgcaagtcgagctcaggca
tctgaagggggaagatatcacatctttgacccacaaagagctgatggccttagagaatgcacttgaaaatggccttgcaa
gtaaccgggacaagcagtccaagttcgtcgacatgctcagagaaaatgaaagagcactggaagaggagcataagcgcctc
acttatgagctgcacaaacaggagatgaaaattgaagagaatgtgagagagttggaaaatgggtatcgtcagaggctggg
gaactacaacaaccagataccgtttgcctttcgtgttcagcctattcagccaaatctgcaggagagaatgtaa
back to top