MADS12a, MADS12a (gene) Malus x domestica

Gene Overview
Name MADS12a
Gene Symbol MADS12a
Type gene
Organism Malus x domestica
Synonym MADS box protein
Description putative role in floral transition
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSMalus x domesticagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS12aAJ320188.1-MADS12a.m1Malus x domesticamRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly AJ320188.1-MADS12a.m1 Chr09:5139650..5151947
chr9:4439787..4452168
AJ320188.1

Sequence(s):
>AJ320188.1-MADS12a.m1744
atgggaagaggtaaggtgcagatgaagcggatcgagaacaagataagcaggcaagtaacgttttcaaagaggaggagtgg
attgctcaaaaaagctcatgagatctctgttctgtgtgatgctgaggtggcagttattgtcttctccaccgtagggaagc
tctttgagtattctactgatttcagcatggtgaggattctggatcgatacgaccaatattcctatgcagaacggcaacgc
accggagctgattctgaatcacaggaaaactggccggtggaataccccaagcttgcggcaaggattgaagtcttacaaag
gaaactaaggaatttggtgggagaagatttagaccccttaagcttgagagagcttcaagatttggagcaacagcttgata
cagctcttaagcgcatacgaacaagaaagaaccaactcgtgcatgaatccatttcagagatggacaagaagcgaaaggct
ctacgggaactaaacaagtcgctagcaaagaaggtgaaggagaataaaacgatgcttgaggaagaacatgaccaggtgca
ggtagtagggcagcagcaaactaaccaaggccgccacaactcatccaccctcatgctcatgccgccgccgccccaacccc
catcaacaccaacactacctacttttcgaaccaccaggtacgatctctctctctctctctctctcagcgatgtttctgtt
aagcaatatgcagaaggagaatag
back to top