MADS13-3, MADS13-3 (gene) Pyrus pyrifolia var. culta

Gene Overview
Name MADS13-3
Gene Symbol MADS13-3
Type gene
Organism Pyrus pyrifolia var. culta
Synonym dormancy-associated MADS-box transcription factor
PpMADS13-3
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS13-3AB774474.1-MADS13-3.m1Pyrus pyrifolia var. cultamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSPyrus pyrifolia var. cultagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AB774474.1-MADS13-3.m1 scaffold00255:224712..232192
AB774474.1

Sequence(s):
>AB774474.1-MADS13-3.m1705
atggtggaaaggatgaaagagaagataaagatcaggaggatcgactaccttcctgcaaggcaggtgaccttctcaaagag
gagtagagggattctcaagaaagctgaagagctatcgattctgtgtgaagctgaagttgctgttatcatcttttctcaaa
ctggcaagctctttgattactcaagctccagtaccaaggatgtgattgcaaggtacaaatcacatactggtggggaaaaa
tgggatcaaatcacgcttcatcaactgcagttggagaaagaaaacacgatgaggctgagtaaggaacttgaggataagac
ccgcaagctgaggcagatgaagggtgaggaccttcaagacttggatctggatcaactgaacaagttagaaaaattggtgg
aagcaagcattggccgtgtgattaaaactaagaaaaaaaagattatgagtgagattatggcacatgcgaataagggagct
gagcttatagacgctaacaaccagctaaagcagagggtggtgatgttatccgctggaggagatatcggacctgcagggat
catggagttggacaacctgaataatgttggagaagaaggcgtgacatctgaatcagccacaaatgtcaccacctgctcca
gcagtgctttttctctcgaagatgactgctccgacatcttgtctctcaaactggggcttccttag
back to top