MADS13, MADS13 (gene) Malus x domestica

Gene Overview
Name MADS13
Gene Symbol MADS13
Type gene
Organism Malus x domestica
Synonym B-type MADS box protein
MADS-box protein
MdiMADS13
Description determination of petal and stamen identity
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSMalus x domesticagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS13AJ251116.1-MADS13.m1Malus x domesticamRNA
MADS13AB081094.1-MADS13.m1Malus x domesticamRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly AJ251116.1-MADS13.m1 Chr02:11387341..11389477
chr2:12242009..12244143
chr2:12242006..12244142
AJ251116.1
predicted genes from whole genome assembly AB081094.1-MADS13.m1 Chr02:11387341..11387695
chr2:12243789..12244143
chr2:12243788..12244142
AB081094.1

Sequence(s):
>AJ251116.1-MADS13.m1699
atgggtcgtgggaagattgaaatcaagctgatcgaaaaccagaccaacaggcaggtgacctactccaagagaagaaatgg
gatcttcaagaaggctcaggagctcaccgttctctgtgatgccaaggtctccctcattatgctctccaacactaataaaa
tgcacgagtatatcagccctaccactacgaccaagagtatgtatgatgactatcagaaaactatggggatcgatctgtgg
aggacacacgaggagtcgatgaaagacaccttgtggaagttgaaagagatcaacaataagctgaggagagagatcaggca
gaggttgggccatgatctaaatggcctgagctttgacgagctggcttctcttgacgatgagatgcagtcttccttggatg
ccatacgtcaaaggaagtaccatgtgatcaaaactcagacggagaccaccaagaagaaggttaagaacttggagcaaaga
agaggaaacatgctgcatggctattttgaccaggaagcagccggcgaggatccacagtatggttatgaggacaatgaggg
agactacgaatctgcacttgcattgtcaaatggggcgaataacttgtacactttccacctccaccaccgtaacctccacc
acggaggaagttcgctcggctcctccattactcatctgcacgatctccgccttgcttga
back to top
>AB081094.1-MADS13.m1241
ggttaagaacctggagcaaagaagaggaaacatgctgcatggctattttgaccaggaagcagccggcgaggatccacagt
atggttatgaggacaatgagggagactacgaatctgcacttgcattgtcaaatggggcgaataacttgtacactttccac
ctccaccaccctaacctccaccacggaggaagttcgctcggctcctccattactcatctgcacgatctccgccttgcttg
a
back to top