MADS14, MADS14 (gene) Malus x domestica

Gene Overview
Name MADS14
Gene Symbol MADS14
Type gene
Organism Malus x domestica
Synonym MADS domain class transcription factor
C-type MADS box protein
Description determining stamen and carpel formation
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS14HM122598.1-MADS14.m1Malus x domesticamRNA
MADS14AJ251117.1-MADS14.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HM122598.1-MADS14.m1 Chr09:12332230..12338090
chr9:12045064..12051163
chr9:12629770..12635869
HM122598.1
predicted genes from whole genome assembly AJ251117.1-MADS14.m1 Chr09:12332230..12338090
chr9:12045064..12051163
chr9:12629770..12635869
AJ251117.1

Sequence(s):
>HM122598.1-MADS14.m1729
atggagttcgcaaatcaagcacctgagagctctacccaaaaaaaattgggaagaggcaaaattgagattaagcggatcga
aaacactaccaatcgacaagtcaccttctgcaaacgccgcaacggattgcttaagaaagcctatgaattgtctgttcttt
gtgatgctgaagttgctcttatcgtcttctccacccgtggccgcctctatgagtatgctaacaacagcgttagagcaaca
atcgacaggtacaaaaaagcatgcgctgattctacggacggtggatctgtatcagaagctaacactcagttttatcagca
ggaagcatcaaaactgcgaagacagatccgagaaattcagaattcaaacaggcatatactgggggaatcccttagcacct
tgaaagtcaaggaactgaaaaacctagaaggaagattggagaaaggaatcagcagaataagatccaaaaagaatgaaatc
ctgttttctgaaatcgaattcatgcaaaagagggagactgagctgcaacaccacaacaattttctgagagcaaagatagc
tgaaagcgagagggaacagcagcagcagcaaacacatatgatgccgggaacttcctacgatccgtcgatgccttcgaatt
cgtatgacaggaacttcttccctgtgatcttggagtccaataataaccattaccctcgccaaggccagacagctctccaa
cttgtttga
back to top
>AJ251117.1-MADS14.m1729
atggagttcgcaaatcaagcacctgagagctctacccaaaaaaaattgggaagaggcaaaattgagattaagcggatcga
aaacactaccaatcgacaagtcaccttctgcaaacgccgcaacggattgcttaagaaagcctatgaattgtctgttcttt
gtgatgctgaagttgctcttatcgtcttctccacccgtggccgcctctatgagtatgctaacaacagcgttagagcaaca
atcgacaggtacaaaaaagcatgcgctgattctacggacggtggatctgtatcagaagctaacactcagttttatcagca
ggaagcatcaaaactgcgaagacagatccgagaaattcagaattcaaacaggcatatactgggggaatcccttagcacct
tgaaagtcaaggaactgaaaaacctagaaggaagattggagaaaggaatcagcagaataagatccaaaaagaatgaaatc
ctgttttctgaaatcgaattcatgcaaaagagggagactgagctgcaacaccacaacaattttctgagagcaaagatagc
tgaaagcgagagggaacagcagcagcagcaaacacatatgattccgggaacttcctacgatccgtcgatgccttcgaatt
cgtatgacaggaacttcttccctgtgatcttggagtccaataataaccattaccctcgccaaggccagacagctctccaa
cttgtttga
back to top