MADS19, MADS19 (gene) Malus x domestica

Gene Overview
Name MADS19
Gene Symbol MADS19
Type gene
Organism Malus x domestica
Synonym MADS domain class transcription factor
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS19HM122602.1-MADS19.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HM122602.1-MADS19.m1 Chr08:27930561..27937555
chr8:32436985..32443537
HM122602.1

Sequence(s):
>HM122602.1-MADS19.m1675
atggggaggggaaagattgaaatcaagaggatcgagaacacgacgaatcggcaagtgaccttctgcaaacgaagaaatgg
gctgctgaagaaagcatatgaactatccattctctgtgatgctgaagttgccctcattgtcttctctactcgtggccgtc
tctacgagtactctaacaacaacagcataagaaacaccatagagaggtacaagaaggcatgttcagatagcacaggatca
tcctctgttactgaaattaacgctcagtattatcaacaggaatcggcaaaactgaggcaacagattcaaatgctgcagaa
ctctaacaggcacttaatgggagatgccttgagcactctgactgtgaaagaactaaagcaggtggagaataggcttgaac
gaggcattactagaatcaggtccaagaagcatgaactgctgcttgcagagattgagtacttccagaaaaaggagattgag
ctggaaaacgaaaatgtttatcttcgaactaaggtatcagaagtcgagaggcttcaacaagcaaacatggtttctgggtc
agagatgaatgcaatccaggcattagcttctcgccatttctttagccagaatatgatcgagggtggaggagctaccttcc
cacagcaagacaagaagaacctccatcttgggtaa
back to top