MADS1, MADS1 (gene) Prunus dulcis

Gene Overview
Name MADS1
Gene Symbol MADS1
Type gene
Organism Prunus dulcis
Synonym MADS-box transcription factor
Description NA
Comment PrdMADS1
Evidence for the gene structure imported from NCBI
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSPrunus dulcisgene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS1AY947462.1-MADS1.m1Prunus dulcismRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AY947462.1-MADS1.m1 scaffold_1:44885011..44889611
AY947462.1

Sequence(s):
>AY947462.1-MADS1.m1666
atggggagaggaaagattgagatcaagaggatcgagaacaccacaaaccgtcaagtgaccttctgcaaacgaagaaatgg
actgctgaagaaagcttatgagctatccattctctgtgatgctgaagttgccctcattgtcttctccagtcgaggccgcc
tctacgagtactccaacaacaacataagaaacactatagaggggtacaagaaggcttgctcagatagctcaggttcaacc
tccattaccgaaattaatgctcaatattatcaacaggaatcggcaaagctgaggcaacagattcaaatgctgcagaattc
caacaggcacttaatgggagatgccttgagtactttgagtgtgaaagagctaaagcagctggagaataggcttgaacgag
gcattaatagaatcaggtccaagaagcatgaaatgctgcttgcagaaattgagtacttgcagaaaaaggagatcgagctg
gaaaacgaaaatgtgtgtcttcgaactaagatttcagaagttgagaggcttcaacaagcaaacatggttgggccagagct
gaatgcaatccaggcattagcttctcgcaatttctttagccaaaatatgatggagggtggagcaacctacccacagcaag
acaagaagattctccatcttgggtaa
back to top