MADS1, MADS1 (gene) Prunus persica

Gene Overview
Name MADS1
Gene Symbol MADS1
Type gene
Organism Prunus persica
Synonym MADS1
APETALA1-like protein
Description NA
Comment PpMADS1
Evidence for the gene structure imported from NCBI
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS1HM367064.1-MADS1Prunus persicagene
MADS1HM245384.1-MADS1Prunus persicagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS1HM367064.1-MADS1.m1Prunus persicamRNA
MADS1EU079377.1-MADS1.m1Prunus persicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSPrunus persicagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database HM367064.1-MADS1 N/A HM367064.1
gene parsed from NCBI nr database HM245384.1-MADS1 N/A HM245384.1
mRNA parsed from NCBI nr database HM367064.1-MADS1.m1 N/A HM367064.1
mRNA parsed from NCBI nr database EU079377.1-MADS1.m1 scaffold_1:27954860..27957260
EU079377.1

Sequence(s):
>HM367064.1-MADS11817
caacctcacgtactatattgtctgtcattcaacaacacaacattgaaaaatgcgccccccccccccggcacaccgttcca
agcaaactctcgacacaagtcatcagtagaacaataactaaatgactcaacttagtaagaaatacaaagaagttagattt
gacatgacatgttattgtcaaacttaatcataaattattattctaatgcgtgccacaaactgaatatttccttcgccaaa
caggtttaataaattaacaaattaatcatttttcttatgcaaagcgatattctaaagagtgttgttatttcaacccacct
gtcttatttccccattcacttatcttcaaaattttaaaaacaaattaacccctttgtaaattgacttctatatcccttaa
ctaattgttgacacataaatactcactttactctaagctgacactgttaagtcaaaacaataaaagtaaaaataaaaaca
aaaaaattagaagaaaaaaggccaacaaacaaccaccagaccacccacccagcaccacaaaccgacctcccctcctcacc
tcaccaccagccacatattcaacattcttcaaaactccaaaaccatgcaatcccaattccacatatatattcaacattct
tcaaaaccacacaatcccaacttcataaattcaatattttagaaaacctcaaaaacccaattctaaaaattctactactt
tttataacgtagcagacctaattccacaaattcaatcattttcaaaacccaacaaacccaatttcacaatttcaataatt
ttcaaaacccaacaagagggccaacaacgagaaggaacacgcgcataaaatctttgtagcacttgagcatgtcagggttt
agggtttaggtacatcaaaggtggttcatgttaggtttggtggaaggtacatcacaggtggttctttttagctttggtgg
agtgcgcggcgcttgctgaattgaaaattttcattatctaagtgttttttttttggactcaacaatgtgaagttagggtt
aaaaagttttaagtgaatatctaattgtcaataattaaaaggtattttagaaataatgatgggtaaaaatataaaatatt
attttttaaaatttaaaaagtgagtgaaaaataagacagaagtaaaaataacatcactcatttaaaattactctaattta
cacaaaacggatatacaaactcgaattaatgataactggcacagtaacttgaacaattaatgaacccaaaagtgctttca
aatacaaatgcttaaacggtcaacatcacggtaatgtgccatgcgaaagctgtcagtgtaaagaagaccgtacgatgtgt
gaggctaataagtaactagtgagctactaaatgagctccactagaatacaagaaagataaaatgtggttcctaatacaga
gggaaacgacgacacattacaccccagccaaccacaactcgacaacacatcctcaaaaccacttgtactccctgaaaccg
cttttccatctcaactcgtgccatgttaattataatcctcattttccatatcctgcacacactttctcaggcgccttcag
agctttggctacaagaagaaaaaaaaaacaaaattaattcagttcagttcatttctttatatatatagggtttcaagttg
ctgtctttctttttttggggctaggcttggattttgctcttgtttgggttttttggtgaaagaaaaattaaagaggcagg
aggtgcaagcaaaagagtgtaaagttttaactgagagagatcgtaactgttatcatg
back to top
>HM245384.1-MADS11814
caacctcacgtactatattgtctgtcattcaacaacacaacattgaaaaatgcgccccccccccccggcacaccgttcca
agcaaactctcgacacaagtcatcagtagaacaataactaaatgactcaacttagtaagaaatacaaagaagttagattt
gacatgacatgttattgtcaaacttaatcataaattattattctaatgcgtgccacaaactgaatatttccttcgccaaa
caggtttaataaattaacaaattaatcatttttcttatgcaaagcgatattctaaagagtgttgttatttcaacccacct
gtcttatttccccattcacttatcttcaaaattttaaaaacaaattaacccctttgtaaattgacttctatatcccttaa
ctaattgttgacacataaatactcactttactctaagctgacactgttaagtcaaaacaataaaagtaaaaataaaaaca
aaaaaattagaagaaaaaaggccaacaaacaaccaccagaccacccacccagcaccacaaaccgacctcccctcctcacc
tcaccaccagccacatattcaacattcttcaaaactccaaaaccatgcaatcccaattccacatatatattcaacattct
tcaaaaccacacaatcccaacttcataaattcaatattttagaaaacctcaaaaacccaattctaaaaattctactactt
tttataacgtagcagacctaattccacaaattcaatcattttcaaaacccaacaaacccaatttcacaatttcaataatt
ttcaaaacccaacaagagggccaacaacgagaaggaacacgcgcataaaatctttgtagcacttgagcatgtcagggttt
agggtttaggtacatcaaaggtggttcatgttaggtttggtggaaggtacatcacaggtggttctttttagctttggtgg
agtgcgcggcgcttgctgaattgaaaattttcattatctaagtgttttttttttggactcaacaatgtgaagttagggtt
aaaaagttttaagtgaatatctaattgtcaataattaaaaggtattttagaaataatgatgggtaaaaatataaaatatt
attttttaaaatttaaaaagtgagtgaaaaataagacagaagtaaaaataacatcactcatttaaaattactctaattta
cacaaaacggatatacaaactcgaattaatgataactggcacagtaacttgaacaattaatgaacccaaaagtgctttca
aatacaaatgcttaaacggtcaacatcacggtaatgtgccatgcgaaagctgtcagtgtaaagaagaccgtacgatgtgt
gaggctaataagtaactagtgagctactaaatgagctccactagaatacaagaaagataaaatgtggttcctaatacaga
gggaaacgacgacacattacaccccagccaaccacaactcgacaacacatcctcaaaaccacttgtactccctgaaaccg
cttttccatctcaactcgtgccatgttaattataatcctcattttccatatcctgcacacactttctcaggcgccttcag
agctttggctacaagaagaaaaaaaaaacaaaattaattcagttcagttcatttctttatatatatagggtttcaagttg
ctgtctttctttttttggggctaggcttggattttgctcttgtttgggttttttggtgaaagaaaaattaaagaggcagg
aggtgcaagcaaaagagtgtaaagttttaactgagagagatcgtaactgttatc
back to top
>HM367064.1-MADS1.m13
atg
back to top
>EU079377.1-MADS1.m1717
atgggaaggggtagggttcagctgaagcgcatagagaacaagatcaacagacaggtgactttttccaaaagaagaactgg
gttgctcaagaaggctcatgagatctctgtcttgtgcgatgctcaggttgctctggttgtcttctccaacaagggcaaac
tctgtgagtacgccacggattcatgcatggatcaaatacttgaccgctacgagagatactcttacgcagaaagacagcta
gtcgaacccgatattgaatcacagtgtaactggaccttcgaatattctagactaaaggctaaagttgagcttttgcaaag
aaatcagaggcactatttgggagaagatctcgattcgttgactctgaaagagatccaaagtttggagcaccagctcgaga
ccgctcttaaacaaattcgatcaagaaaaaaccaactcatgcatgagtccatctctgagcttcagagaaaggaaagggcg
atgcaggagcaaaataacttgttggcaaagaagatcaaggagaaggagaaggcygcagctgaggaggttcataactggga
gcagcaaaacaatggcctcaacttgcttccacagccgcttccatgtctaaacatggggggcacgcagcaagatgaattcc
ttcaggtgaggaggaaccagctggaccttactctggaaccattatattcatgcaacctcggatgctttgctgcttga
back to top