MADS1, MADS1 (gene) Pyrus x bretschneideri

Gene Overview
Name MADS1
Gene Symbol MADS1
Type gene
Organism Pyrus x bretschneideri
Synonym transcription factor MADS
PbMADS1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSPyrus x bretschneiderigene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS1AB265799.1-MADS1.m1Pyrus x bretschneiderimRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AB265799.1-MADS1.m1 scaffold00452:188402..190420
AB265799.1

Sequence(s):
>AB265799.1-MADS1.m1550
ctactccaagagaaggaacggactcttcaagaaggccaacgagctcaccgtcctctgcgacgccgaggtctctctcatca
tggtttcgagctccggcaaagtccacgagtacattagcccctccaccacaacaaagcaattgctggatcagtaccggaag
actcttggaatcgatatttggagctcgcactacgaggcaatgcaagagcatttgaagaagctgaaggaggtgaacatgaa
tcttcggaggcagatcaggcagagagttggggattgtctgaacgatctgagtttcgatgaactgcgtggtctccaggaag
aggtggaagctgccgtcgccgtcattcggcagcgcaaggttcggatgatctctaataagattgatacaaccaagaaaaag
gtaaagagccaagcagatataaacatgagtctccacgaactctatgcgagggacggtatacactatgaattagtagagaa
tgaaggggattatgattcagtgtgtggctgctcaccaaatggaggaggacctcccatatttgcgaagtag
back to top