MADS2.2, MADS2.2 (gene) Malus x domestica

Gene Overview
Name MADS2.2
Gene Symbol MADS2.2
Type gene
Organism Malus x domestica
Synonym MdMads2.2 protein
Description NA
Comment transcription factor
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS2.2DQ205651.1-MADS2.2.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly DQ205651.1-MADS2.2.m1 Chr06:34006631..34010680
chr6:22210819..22214870
chr6:27145448..27149499
DQ205651.1

Sequence(s):
>DQ205651.1-MADS2.2.m1768
atggggaggggaagggtgcagctgaagaggattgagaacaagatcaacaggcaggtgaccttctcaaagagaacgtcagg
gctgctgaagaaagctcatgagatttctgtactttgtgatgctgaggttgctttgattgtcttctctaccaaaggcaagc
tttttgagtactccactgattcctgcatggaaaggatcctggaaaggtacgaaagatactcacatgcagagaggcagctt
cttgcaaatgataatgaatccactgggaactggactctggaacatgcaaagctcaaggctagggtggaggttttacaaag
aaatcaaagtcattatatgggagaagatctccaaatcttaagtttccaagagcttcagaatttagagcaacagcttgatt
ctgcactaaggcgcataaggtcaagaaagaaccaagtcatgtacgaatcgatttctgagctccagaagaaggataaggca
ttgcaggagcaaaacaacttgctggcaaagaatgtaaaggagaaggagaaagcagtaacttcacaggcacaattggacca
tgcgcagaagcagagcttggactcctcctccacccttctaccacaggaattgcagtacttgaatttcagcaggtccaatt
accaccaggctattagatcaagtaatggaatatcaggagataatcagcaggatggagatgaaactgcgactccacataga
cctaacacgctgctgcctccttggatgctccgccaccttaatgaatag
back to top