MADS2, MADS2 (gene) Fragaria chiloensis

Gene Overview
Name MADS2
Gene Symbol MADS2
Type gene
Organism Fragaria chiloensis
Synonym transcription factor MADS-box 2
Description NA
Comment MADS2
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS2GQ398010.1-MADS2.m1Fragaria chiloensismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSFragaria chiloensisgene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database GQ398010.1-MADS2.m1 N/A GQ398010.1

Sequence(s):
>GQ398010.1-MADS2.m1729
atggagagggggagagtagagctgaagaggatagagaacaagatcaacaggcaggtgacctttgcaaagagaaggaacgg
actattgaagaaagcctacgagctttccgttctttgcgatgccgaggttgctctcatcatcttctccaatagaggaaagc
tgtacgagttttgcagtagttcaagcatgctcaaaacactggagaggtaccagaagtgcaactatggagcaccagagaca
aatgtatctacaagggaggccttggaattgagtagccaacaggagtatttgaagctcaaggcacgttatgaagccctaca
aagaaaccaaaggaatcttcttggagaagatcttggccctttgagcagcaaggagctcgaatcacttgaaaggcagctgg
atatgtcactgaagcagatcagatcaacacggacccaatgcatgctggatcagctcacagatcttcagcgaaaggaacac
ttgcttaacgaggcaaacaggacactgaaacaaaggttgtttgagggataccatcatcaactccaactgaatgcaaatgc
tgaggaagtggcatatggccggcaagaagctcatcagcctcagggcgatggcttcttccaagccttagagtgcgagccca
cattacaaattgggtatcaccagaatgatccgatacaagtcgtgacggccgggccgagcgtgaattacatgggaggatgg
ttgccatga
back to top