MADS2, MADS2 (gene) Malus x domestica

Gene Overview
Name MADS2
Gene Symbol MADS2
Type gene
Organism Malus x domestica
Synonym MADS domain class transcription factor
MADS-box protein 2
Description floral development|flowering time
Comment MdMADS2; transcription factor
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS2HM122603.1-MADS2.m1Malus x domesticamRNA
MADS2U78948.1-MADS2.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HM122603.1-MADS2.m1 Chr14:29952041..29957558
chr14:26876102..26881620
chr14:31494632..31500150
HM122603.1
predicted genes from whole genome assembly U78948.1-MADS2.m1 Chr14:29952041..29957558
chr14:26876102..26881620
chr14:31494632..31500150
U78948.1

Sequence(s):
>HM122603.1-MADS2.m1762
atggggaggggaagggtgcagctgaagagaattgagaacaagatcaacaggcaggtgaccttctcaaagagaaggtcggg
gctgatgaagaaagctcatgagatttctgtgctttgtgatgctgaggttgctttgattatcttctccaccaagggcaagc
tctttgagtactccaatgattcctgcatggaaaggatcctggaaaggtacgaaagatactcatatacagagaggcagctt
cttgcaaatgataatgaatccactggaagctggactctggaacatgcaaagctcaaggctagggtggaggttttacaaag
aaatcaaagacactatatgggagaagatctccaatccttaagtctcaaagagcttcaaaatttagagcaacagcttgatt
ctgcactgaagcacataaggtcaagaaagaaccaagttatgtacgaatcgatttctgagctccagaagaaggataaggca
ttgcaggagcaaaacaacttgctggcaaagaaggagaaggagaacgcagtagctcaacaggcccaattggagcatgtgca
ggagcagaggttgaactcctcttcctcccttcttccacgggcattgcagtccttgaatttcggcagcgggtccaattacc
aggccattagatcaagtgaaggaataccaggagataatcagcagtatggagatgaaaccccaactccacatagacctaac
atgctgctgcccgcttggatgctccgccaccttaatgaatag
back to top
>U78948.1-MADS2.m1768
atggggaggggaagggtgcagctgaagagaattgagaacaagatcaacaggcaggtgaccttctcaaagagaaggtcggg
gctgatgaagaaagctcatgagatttctgtgctttgtgatgctgaggttgctttgattatcttctccaccaagggcaagc
tctttgagtactccaatgattcctgcatggaaaggatcctggaaaggtacgaaagatactcatatacagagaggcagctt
cttgcaaatgataatgaatccactggaagctggactctggaacatgcaaagctcaaggctagggtggaggttttacaaag
aaatcaaagacactatatgggagaagatctccaatccttaagtctcaaagagcttcaaaatttagagcaacagcttgatt
ctgcactgaagcacataaggtcaagaaagaaccaagttatgtacgaatcgatttctgagctccagaagaaggataaggca
ttgcaggagcaaaacaacttgctggcaaagaaggtgaaggagaaggagaacgcagtagctcaacaggcccaattggagca
tgtgcaggagcagaggttgaactcctcttcctcccttcttccacgggcattgcagtccttgaatttcggcagcgggtcca
attaccaggccattagatcaagtgaaggaataccaggagataatcagcagtatggagatgaaaccccaactccacataga
cctaacatgctgctgcccgcttggatcgtccgccaccttaatgaatag
back to top