MADS2, MADS2 (gene) Prunus dulcis

Gene Overview
Name MADS2
Gene Symbol MADS2
Type gene
Organism Prunus dulcis
Synonym MADS-box transcription factor
Description NA
Comment PrdMADS2
Evidence for the gene structure imported from NCBI
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSPrunus dulcisgene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS2AY947463.1-MADS2.m1Prunus dulcismRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AY947463.1-MADS2.m1 scaffold_5:16634910..16637382
AY947463.1

Sequence(s):
>AY947463.1-MADS2.m1768
atggggaggggaagggtgcagctgaagaggattgaaaacaagatcaacaggcaggtgaccttctcaaagagaaggtctgg
gttgctgaagaaagcccaagagatttctgtgctttgtgatgctgaggttgctttgattgtcttctccaccaaaggcaagc
tctttgagtactccactgactcctgcatggaaaggatcctggaaaggtacgaaagatactcatattcagagaagcagctt
cttgcaaatgatcatgaatcaactggaagctggactctggaacatgcgaagctcaaggctagggtggaggttttacaaag
aaattgcagtcattttatgggggaagatctccaatctttaagtctgaaagagcttcagaatttggagcaacagcttgatt
ctgcaccgaagcacataaggtcaaggaagaaccaggttatgtacgaatcgatttcagagctgcaaaagaaggataaggca
ttgcaggagcaaaacaacttgctggcaaagaaggtaaaggagaaggagaaagcactagctccacaggcagagtcatggga
gcagcaagtgcagaaccagggcttggactgctcgtccacccttctaccagaggcattgcagtccttgaatttcggcagcg
gttcaaattaccagggaattagaaatgatggagccggtggagatcatgaggatgaaaatgagaccccgacagcaagtcga
cctaatactctccttcccccatggatgctccgccaccttaatgaatag
back to top