MADS2, MADS2 (gene) Prunus persica

Gene Overview
Name MADS2
Gene Symbol MADS2
Type gene
Organism Prunus persica
Synonym MADS box protein
Description NA
Comment PpMADS2
Evidence for the gene structure imported from NCBI
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSPrunus persicagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS2DQ102369.1-MADS2.m1Prunus persicamRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database DQ102369.1-MADS2.m1 scaffold_5:16626465..16630351
DQ102369.1

Sequence(s):
>DQ102369.1-MADS2.m1756
atgggaagaggtagagttgagctgaagaggatagagaataaaattaacaggcaagtgacttttgccaagagaagaaatgg
gctgctcaagaaagcttatgagctctcagttctctgcgatgctgaggttgccctcataattttctccagccgtggcaaac
tttatgaattctgcagcagtatgagcatgctgaaaacgcttgaaaagtaccaaaggtgcagctatggctccctggaagcc
aacagaccagtcaatgagacccagaacagctatcaggaatatctgaagctgaaagctagagtggaggtcctccaacaatc
tcaaagaaaccttcttggggaagatttggccccactgaacacaaaggagcttgagcagcttgagcatcaactggaggcat
ccttgaaccaaattaggtcaacaaagactcagtttatgcttgatcagctttgtgatctccagaacaaggaacaaatgcta
gttgaagctaacaaagccttgaggaggaagctggaagaaactagtgggcaagcgccacctctattggcatgggaagctgc
tggccatggcaacaacaatgttcagcatactggccttcctcatcatcctcactcacaaggcttcttccatccattgggaa
acaactccacttcccaaattggatacacccccttgggttcagatcatcatgaacaaatgaatgttggaaatcatggccaa
catgtgaatggattcattcctgggtggatgctttga
back to top