MADS3, MADS3 (gene) Taihangia rupestris

Gene Overview
Name MADS3
Gene Symbol MADS3
Type gene
Organism Taihangia rupestris
Synonym MADS-domain protein
Description NA
Comment transcription factor
Evidence for the gene structure imported from NCBI
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSTaihangia rupestrisgene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS3EF469601.1-MADS3.m1Taihangia rupestrismRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database EF469601.1-MADS3.m1 N/A EF469601.1

Sequence(s):
>EF469601.1-MADS3.m1663
atgggacgggggaaggtgcaactgaagcgaatcgagaacaagatcaggaggcaagtgactttctcgaagcggaggagtgg
gttgatcaagaaagctaaagagctctctgttctgtgcggcgttgaagttgggctcatcatcttctccgccaggggtcgac
tttacgagttctgtagcggcgatagcttggagaatgttcttgagcgctaccagatacataatgaagaagaagctggtaat
tccaaaaatggcaagaaaaatcattcggaatcaagtacttctggaacaggtgctaataaatcactgaaaatgatccaaag
tgaactggaagcacataacattcagaatctggatgttacagagcttgctcaactagagaagcaactcgacgcaacattaa
ggcaaacaagaacaagaaagacacagctcatgatggaagctatatcatctctcgtcgacaaggaaaagaagctgggagaa
gagaaggacctcatggaaaaagagattgcagttctgatggaggagcaagcaaaccaccaggaagatcctgctgctgctgc
tgctaatgatgatgatgatgatgatgatgatgatattgaaggagaagaaggtgaagatgaagaacacagcaactccaaac
atccagtgcacaatttcttttaa
back to top