MADS4, MADS4 (gene) Malus x domestica

Gene Overview
Name MADS4
Gene Symbol MADS4
Type gene
Organism Malus x domestica
Synonym MADS-box protein 4
Description floral development|fruit development
Comment MdMADS4; transcription factor
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS4U78950.1-MADS4.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly U78950.1-MADS4.m1 Chr13:4133394..4140612
U78950.1

Sequence(s):
>U78950.1-MADS4.m1708
atgggaagagggaaggtggagttgaagaggatcgagaataagataaatcgacaggtaacatttgcaaaaagaaggaatgg
gctgctaaagaaggcgtacgaactctcagttctctgtgatgctgaggttgctctcatcgtcttctccaccagcggaaagc
tctatgagttctgcagcggccctagcatagcgaagacgcttgagaggcatcaaagatgcacttatggagaactgggagca
agtcaatctgctgaggacgaacagagcagataccaagaatacttgaagctaaaaacgaaagtagaggccctacaacgcac
gcagagacatcttcttggggaagatttggttcatttaggcacgaaggagcttcagcagcttgagaatcaactagatgtgt
cgatgaagaaaatcaggtcaacgaagacccaatttatgcatgttcagatttctgagcttcaaaggaaagaagaaatgcta
ctggaagcaaacactggactgagaaggaagttggaagaaattactgctggccatcaacgatcatggaatggcaatcacca
ggctgctcaattagaaggattccctgagcatttgcaatacaacaatgcattgcagatcggtactccagtagtaacaaatg
atgaggcgaatgtagcaacgtcctcagcacaaaatggtacgggattcttccccggttggatgctctga
back to top