MADS4, MADS4 (gene) Prunus avium

Gene Overview
Name MADS4
Gene Symbol MADS4
Type gene
Organism Prunus avium
Synonym transcription factor MADS4
Description NA
Comment MADS-box protein
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS4JQ686725.1-MADS4.m1Prunus aviummRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSPrunus aviumgene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database JQ686725.1-MADS4.m1 scaffold_3:18619433..18623346
JQ686725.1

Sequence(s):
>JQ686725.1-MADS4.m1735
atggggaggggaagagtggaactcaagaggatagagaacaagataaacaggcaagtcacatttgcaaagagaagaaatgg
gcttctgaagaaagcctatgagctctctattctctgtgatgctgaggttgctctcatcatcttctctaaccgtggcaagc
tctatgagttctgtagcagctctagcatactcaaaacactggaaaggtaccagaagtgcagttatggtcaagtggaagtc
aacaaacctgccaaggaacttgagagcagctaccgcgagtacttgaaactgaaaggtcgatttgagtccctacaacgaac
tcagagaaaccttcttggagaagacttgggtcccttaaacacaaaggagcttgagcagcttgagcgtcaacttgagtcct
ccttgaagcaagttaggtccactaagactcagtatatgctggaccaactttctgaccttcaaaataaggaacagatgtta
atagaagcaaacagggatttgacattgaagttggatgacattagttcaagaaaccaaattagacaatcatgggaaggtgg
aaaccaggggggtatggcatatgggacccagcatgctcaatctcaagggttcttccagcccttggattgcaatcccccct
tgcaaatagggtactctaatgtggggtcagagcagatgagtgccacaactcatgcccaacaagtcaacggtttcatccct
ggatggatgctgtga
back to top