MADS4, MADS4 (gene) Prunus persica

Gene Overview
Name MADS4
Gene Symbol MADS4
Type gene
Organism Prunus persica
Synonym MADS4
Description NA
Comment C-type MADS box protein; specifies stamen and carpel formation; PpMADS4
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS4AY705972.1-MADS4.m1Prunus persicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSPrunus persicagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AY705972.1-MADS4.m1 scaffold_4:3457113..3463235
AY705972.1

Sequence(s):
>AY705972.1-MADS4.m1732
atggcctatgaaaacaaatccatgtctctggactctccccaaagaaaattgggtaggggaaagatcgagatcaagcggat
cgaaaacacaacaaaccgtcaagtcaccttctgcaaaaggcgcaatgggttgctcaagaaggcctatgaactctctgtac
tctgtgatgcagaggttgctctcatagtcttctctaaccgtggccgactttatgagtatgccaacaacagtgttaaagaa
acaattgagaggtacaagaaggcatgcgcagagtctacaaataccggatctgtttccgaagccagtacccagtactacca
acaagaagctgcgaaactgcgcgctcagacagggaatttgcagaactcaagcaggcatatgatgggcgagtcattgagtt
ctatgaatatgaaagacctgaagaatctggagagtaaactagagaaaggaatcaacagaatcagatccaagaagaatgaa
ctcttgtttgccgaaattgagtacatgcagaaaagggaaattgacttgcataacaacaaccagctcctacgagcaaagat
agctgagaatgagaggagccagcaaaacataaatgtgatggctggagggggaagttatgagatcatgcagtctcagccat
atgactctcggaactattttcaagtgaatgcattacaacccaatcatcagtacaattcacgccaagatccgatggccctt
caattagtttaa
back to top