MADS5, MADS5 (gene) Prunus avium

Gene Overview
Name MADS5
Gene Symbol MADS5
Type gene
Organism Prunus avium
Synonym transcription factor MADS5
Description NA
Comment MADS-box protein
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS5JQ686726.1-MADS5.m1Prunus aviummRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSPrunus aviumgene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database JQ686726.1-MADS5.m1 N/A JQ686726.1

Sequence(s):
>JQ686726.1-MADS5.m1741
atggagttcccaaatcaagcacctgagagctcttcccaaagaaaaattggaagaggcaagattgagattaagcggattga
aaacactacaaatcgacaagtcaccttctgcaagcgccgcaacggcttgcttaagaaagcctatgagttatctgttctat
gtgatgctgaagttgctcttattgtcttctctacccgtggccgcctgtatgagtatgctaacaacagcgttagagcaacg
attgataggtacaaaaaagcatgcactgattctacgaacggtggatctgtttctgaagctaacactcagttttatcagca
ggaatcatctaaattacgaagacaaatccgcgaaatccagaactcaaacaggcatatactgggtgaagctcttagcactt
tgaacatcaaggaactcaagaacctagaaggaagactggagaaagggatcagcagaataagatccaaaaagaatgaaatg
ctgtttactgaaatcgaatttatgcaaaagagggagatcgagctgcaaaaccataacaattatctgagagcaaagatagc
tgaaaatgaaagggcacaacagcagcaaacaaatatgattcaaggaacttcttatgatcagtcaatgccttcacagtcat
acgacaggaacttcctccctgtaatgttggaggccaataataataataataataataaccattactctcgccatgaccag
acagctctccaacttgtttga
back to top