MADS6, MADS6 (gene) Malus x domestica

Gene Overview
Name MADS6
Gene Symbol MADS6
Type gene
Organism Malus x domestica
Synonym MADS-box transcription factor
MADS-box protein
Description MADS box transcription factor
Comment MADS-box protein
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS6JN651403.1-MADS6.m1Malus x domesticamRNA
MADS6AJ000760.1-MADS6.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly JN651403.1-MADS6.m1 Chr06:33919680..33924580
chr6:22153263..22158163
chr6:27100746..27105646
JN651403.1
predicted genes from whole genome assembly AJ000760.1-MADS6.m1 Chr06:33919688..33924580
chr6:22153271..22158163
chr6:27100754..27105646
AJ000760.1

Sequence(s):
>JN651403.1-MADS6.m1747
atgggcagaggtaaagttgagctgaagaggatagagaataaaagtaacaggcaagtgactttttccaagagaagaaatgg
gctgctcaagaaagcttttgaactctcagttctctgcgatgctgaggttgccctcattattttctctggccgtggcaagc
tctatgaattctctagcagtttaagcatgatgaaaacgcttgaaaggtaccaaagatgcagttatagttccctggacgcc
aaccgacctgccaacgagactcagaacagctatcaggagtatttgcagctggagacaagagttgaggccctccaacaatc
tcaaagaaaccttcttggggaagatttggccaccctgaacacaaagaagcttgaggagcttgagcatcaactagagacct
ccttgaacaaaattaggtcaacaaagactcaatttatgcttgatcagctttctgatcttcaaaacagggaacaaatgcta
attgaagctaataaagccttgaggaggaagctggaagaaacaagtgtgcaagctccacaatttatggcatgggaagctgc
tggcgatggccacaacaatattcagcaaacttggcttccttccaactcagaagctttcttccatcccttgggaggaaaca
actccacttcccaaattggatacgcccatttgggttcacataatggaatggatgttggaaatccgggccagcatgttaat
ggatacattcctgggtggatgctttga
back to top
>AJ000760.1-MADS6.m1739
aggtaaagttgagctgaagaggatagagaataaaagtaacaggcaagtgactttttccaagagaagaaatgggctgctca
agaaagcttttgaactctcagttctctgcgatgctgaggttgccctcattattttctctggccgtggcaagctctatgaa
ttctctagcagtttaagcatgatgaaaacgcttgaaaggtaccaaagatgcagttatagttccctggacgccaaccgacc
tgccaacgagactcagaacagctatcaggagtatttgcagctggagacaagagttgaggccctccaacaatctcaaagaa
accttcttggggaagatttggccaccctgaacacaaagaagcttgaggagcttgagcatcaactagagacctccttgaac
aaaattaggtcaacaaagactcaatttatgcttgatcagctttctgatcttcaaaacagggaacaaatgctagttgaagc
taataaagccttgaggaggaagctggaagaaacaagtgtgcaagctccacaatttatggcatgggaagctgctggcgatg
gccacaacaatattcagcaaacttggcttccttccaactcagaagctttcttccatccctttggaggaaacaactccact
tcccaaattggatacgcccatttgggttcacataatggaatggatgttggaaatccgggccagcatgttaatggatacat
tcctgggtggatgctttga
back to top