MADS6, MADS6 (gene) Prunus persica

Gene Overview
Name MADS6
Gene Symbol MADS6
Type gene
Organism Prunus persica
Synonym MADS6
Description NA
Comment MADS-box protein; transcription factor; PpMADS6
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS6AY705973.1-MADS6.m1Prunus persicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSPrunus persicagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AY705973.1-MADS6.m1 scaffold_5:16634910..16637382
AY705973.1

Sequence(s):
>AY705973.1-MADS6.m1768
atggggaggggaagcgtgcagctgaagaggattgaaaacaagatcaacaggcaggtgaccttctcaaagagaaggtctgg
gttgctgaagaaagcccaagagatttctgtgctttgtgatgctgaggttgctttgattgtcttctccaccaaaggcaagc
tctttgagtactccactgactcctgcatggaaaggatcctggaaaggtacgaaagatactcatattcagagaagcagctt
cttgcaaatgatcatgaatcaactggaagctggactctggaacatgcgaagctcaaggctagggtggaggttttacaaag
aaattgcagtcattttatgggggaagatctccaatctttaagtctgaaagagcttcagaatttggagcaacagcttgatt
ctgcactgaagcacataaggtcaagaaagaaccaggttatgtacgaatcgatttcagagctgcaaaagaaggataaggca
ttgcaggagcaaaacaacttgctggcaaagaaggtaaaggagaaggagaaagcactagctccacaggcagagtcatggga
gcagcaagtgcagaaccagggcttggactgctcctccacccttctaccagaggcattgcagtccttgaatttcggcagcg
gttcaaattaccagggaattagaaatgatggatccggtggagatcatgaggatgaaaatgagaccccgacagcaaatcga
cctaatactctccttcccccatggatgctccgccaccttaatgaatag
back to top