MADS7, MADS7 (gene) Malus x domestica

Gene Overview
Name MADS7
Gene Symbol MADS7
Type gene
Organism Malus x domestica
Synonym MADS domain class transcription factor
MADS-box protein
Description MADS-box transcription factor
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS7HM122610.1-MADS7.m1Malus x domesticamRNA
MADS7AJ000761.1-MADS7.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HM122610.1-MADS7.m1 Chr14:29920958..29926237
chr14:26820863..26826125
chr14:31465643..31470905
HM122610.1
predicted genes from whole genome assembly AJ000761.1-MADS7.m1 Chr14:29920958..29926237
chr14:26820863..26826125
chr14:31465643..31470905
AJ000761.1

Sequence(s):
>HM122610.1-MADS7.m1747
atgggcagaggcagagttgagctgaagaggatagagaataaaattaacaggcaagtgacttttgccaaaagaagaaatgg
gctgctcaagaaagcttatgagctctcagttctctgcgatgctgaggttgccctcattattttctctagccgtggcaagc
tctatgaattctgtagcagtttcagcatgatgaaaacgcttgaaaagtaccaaagttgcagttatggttccctggaagcc
aacctaccagccaacgagacccagaacagctatcaggactatttgatgttgaaggcaagagttgaggtcctccaacaatc
tcaaagaaaccttcttggggaagatttgtcccacctgaacacaaaggagcttgagcatcttgagcatcaattggagacct
ctttgaagcaaattaggtcaagaaagactcagtttattctcgatcagctttctgatcttcaaaacagggaacagatgcta
gttgaagctaacaaagccttgaagaggaagctggaagaaacaagtgtgcaagctccagaaggaatggcatgggaagctgc
tggccatggccccaacaacattcagcaaactcggcttccttcccactcagaagccttcttccatcccttggaaggaaaca
actccagttcccaaattggatacacccatatgggttcagataatgaaatgaatgttggaaatccgggccagtatgttaat
ggatatattcctgggtggatgctttga
back to top
>AJ000761.1-MADS7.m1747
atgggcagaggcagagttgagctgaagaggatagagaataaaattaacaggcaagtgacctttgccaaaagaagaaatgg
gctgctcaagaaagcttatgagctctcagttctctgcgatgctgaggttgccctcattattttctctagccgtggcaagc
tctatgaattctgtagcagtttcagcatgatgaaaacgcttgaaaagtaccaaagttgcagttatggttccctggaagcc
aacctaccagccaacgagacccagaacagctatcaggactatttgatgttgaaggcaagagttgaggtcctccaacaatc
tcaaagaaaccttcttggggaagatttgtcccacctgaacacaaaggagcttgagcatcttgagcatcaattggagacct
ctttgaagcaaattaggtcaagaaagactcagtttattctcgatcagctttctgatcttcaaaacagggaacagatgcta
gttgaagctaacaaagccttgaagaggaagctggaagaaacaagtgtgcatgctccagaaggaatggcatgggaagctgc
tggccatggccccaacaacattcagcaaactcggcttccttcccactcagaagccttcttccatcccttggaaggaaaca
actccagttcccaaattggatacacccatatgggttcagataatgaaatgaatgttggaaatccgggccagtatgttaat
ggatatattcctgggtggatgctttga
back to top