MADS7, MADS7 (gene) Prunus persica

Gene Overview
Name MADS7
Gene Symbol MADS7
Type gene
Organism Prunus persica
Synonym transcription factor MADS7
Description NA
Comment MADS-box protein
Evidence for the gene structure imported from NCBI
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSPrunus persicagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS7EF440352.1-MADS7.m1Prunus persicamRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database EF440352.1-MADS7.m1 scaffold_3:18619433..18623346
EF440352.1

Sequence(s):
>EF440352.1-MADS7.m1738
atggggaggggaagagtggaactcaagaggatagagaacaagataaacaggcaagtcacatttgcaaagagaagaaatgg
gcttctgaagaaagcctatgagctctctattctctgtgatgctgaggttgctctcatcatcttctctaaccgtggcaagc
tctatgagttctgtagcagctctagcagcatactcaaaacactggaaaggtaccagaagtgcagttatggtcaagtggaa
gtcaacaaacctgccaaggaacttgagagcagctaccgcgagtacttgaaactgaaaggtcgatttgagtccctacaacg
aactcagagaaaccttcttggagaagacttgggtcccttaaacacaaaggagcttgagcagcttgagcgtcaactggagt
cctccttgaagcaagttaggtccactaagactcagtatatgctggaccaactttctgaccttcaaaataaggaacaaatg
ttaatagaagcaaacagggatttgtcattgaagttggatgacattagttcaagaaaccaaattagacaatcatgggaagg
tggaaaccaggggggtatggcatatgggagccagcatgctcaatctcaagggttcttccagcccttggattgcaatccca
ccttgcaaatagggtactctaatgtggggtcagagcagatgagtgccacaactcatgcccaacaagtcaacggtttcatc
cctggatggatgctgtga
back to top