MADS8-1, MADS8-1 (gene) Pyrus pyrifolia var. culta

Gene Overview
Name MADS8-1
Gene Symbol MADS8-1
Type gene
Organism Pyrus pyrifolia var. culta
Synonym MADS-box protein
PpMADS8-1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS8-1AB623162.2-MADS8-1.m1Pyrus pyrifolia var. cultamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSPyrus pyrifolia var. cultagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AB623162.2-MADS8-1.m1 N/A AB623162.2

Sequence(s):
>AB623162.2-MADS8-1.m1660
atggtgagggggaagactcagatgaagcgcatcgaaaatgcagcgagcaggcaagtgactttttccaagagaagaaatgg
gctgctgaagaaagcctttgagctttcagtcctgtgtgatgctgaagttgcacttgtgatcttctccgcaagagggaagc
tctatgagttttcgagcactagcatcagaagcacaatagaacgttaccaaatgagagtgaaggatcaaggccagctcact
actaaagcatttcaagaagatatggagcatgagacgaatgacactcaaaccttggccaaaaagatcgagtctattgaagc
ttctaaaaggaagctgttaggtaatgatttggaatcatgttccatggaggaactacatcagacagagaaccaactggagc
gaagcttaaaaaaaattagggccaaaaagaatcagttattgagggagcaaatagataagctgaaggaagaggagaaaaac
ctattggaacaaaatgcaaagctacgggaaatgtgtggcatgcaatcacttggtccttcgggaaaaagcaagcatggaga
tgatcgtgaagtattccagccccagacaccaaatgtggacgtggagacggatttgttcatcgggccacctaaaagacaac
aaagtagccaaaaactatag
back to top