MADS9, MADS9 (gene) Malus x domestica

Gene Overview
Name MADS9
Gene Symbol MADS9
Type gene
Organism Malus x domestica
Synonym MADS domain class transcription factor
MdMADS9
Description MADS-box transcription factor
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS9HM122611.1-MADS9.m1Malus x domesticamRNA
MADS9AJ001682.1-MADS9.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HM122611.1-MADS9.m1 Chr09:5120774..5125620
chr9:4405115..4409960
chr9:4406417..4411445
HM122611.1
predicted genes from whole genome assembly AJ001682.1-MADS9.m1 Chr09:5120784..5125620
chr9:4405125..4409960
chr9:4406417..4411435
AJ001682.1

Sequence(s):
>HM122611.1-MADS9.m1741
atggggagaggaagagtggagctgaagaggatagagaacaagataaacaggcaagacacatttgcaaagagaagaaatgg
gcttctgaagaaagcttatgagctctccgttctctgtgatgctgaggttgctctcatcgtcttttccaaccgtggcaagc
tctatgagttttgtagcagccctagcattctccaaaccgtagacaggtaccaaaagtgtagttatggtgcggtggatcaa
gtcaacatacctgcaaaggaacttgagagcagctatcgtgagtacatgaaactcaaaggtagatgtgagtccctacaacg
aactcagagaaatcttcttggtgaggaattgggtccattaaacacaaaggagcttgaacagcttgagcgccaacttgagg
cctccttgaagcaagttaggtccactaagacccagtatatgctggaccaactttctgcccttcagaacaaggaacaactg
ttaatcgaagccaacagggatttgacaatgaagttggatgaaattggttcaagaaatcaacttagacagtcatgggaagg
aggtgaccagggtatggcatatggaacccagcatcaccatgctcaatcccaagggttcttccagcctttagattgcaatc
ccactttgcaaatagggtaccctgcagaggggtcagagcagatgggtgccacaactcatgcccaacaagtgaactgtttc
atccctggatggatgctttga
back to top
>AJ001682.1-MADS9.m1731
gaagagtggagctgaagaggatagagaacaagataaacaggcaagtcacatttgcaaagagaagaaatgggcttctgaag
aaagcttatgagctctccgttctctgtgatgctgaggttgctctcatcgtcttttccaaccgtggcaagctctatgagtt
ttgtagcagccctagcattctccaaaccgtagacaggtaccaaaagtgcagttatggtgcggtggatcaagtcaacatac
ctgcaaaggaacttgagagcagctatcgtgagtacatgaaactcaaaggtagatgtgagtccctacaacgaactcagaga
aatcttcttggtgaggaattgggtccattaaacacaaaggagcttgagcagcttgagcgccaacttgaggcctccttgaa
gcaagttaggtccactaagacccagtatatgctggaccaactttctgcccttcagaacaaggaacaactgttaatcgaag
ccaacagggatttgacaatgaagttggatgaaattggttcaagaaatcaacttagacagtcatgggaaggaggtgaccag
ggcatggcatatggaacccagcatcaccatgctcaatcccaagggttcttccagcctttagattgcaatcccactttgca
aatagggtaccctgcagaggggtcagagcagatgggtgccacaactcatgcccaacaagtgaactgtttcatccccggat
ggatgctttga
back to top