MADS, MADS (gene) Malus x domestica

Gene Overview
Name MADS
Gene Symbol MADS
Type gene
Organism Malus x domestica
Synonym MADS-box transcription factor
MADS-box protein
MdTM6
MdiPI
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSMalus x domesticagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADSAB370211.1-MADS.m1Malus x domesticamRNA
MADSAB081093.1-MADS.m1Malus x domesticamRNA
MADSAB081092.1-MADS.m1Malus x domesticamRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly AB370211.1-MADS.m1 Chr15:50452606..50458725
chr15:42463701..42468730
chr15:49373326..49378355
AB370211.1
predicted genes from whole genome assembly AB081093.1-MADS.m1 Chr15:20927360..20929691
chr6:14318834..14321139
chr5:20431588..20433894
AB081093.1
mRNA parsed from NCBI nr database AB081092.1-MADS.m1 chr8:20663666..20666560
chr8:25019074..25021968
AB081092.1

Sequence(s):
>AB370211.1-MADS.m1672
atggggaggggaaagattgaaatcaagaggattgagaacacgacgaatcggcaagtgaccttctgcaaacgaagaaatgg
gctgctgaagaaagcatatgaattatccattctctgtgatgctgaaattgccctcattgtcttctctagccggggccgtc
tctacgagtactctaacaacaacagtataagaaacaccatagagaggtacaagaaggcatgttcagatagcacaggatca
acttctattactgaaattaatgctcagtattatcaacaggaatcggcaaaactgaggcaacagattcaaatgctgcagaa
ctataacaggcacttaatgggagatgccttgagtaatctgactgtgaaagaactaaagcagctggagaataggcttgaac
gaggcatgactagaatcaggtccaagaaggatgaaatgctgattgcagagattgagtacttgcagaaaaaggagattgag
ctggaaaacgaaaatgtttatcttcgaactaagatatcagaagttgagaggcaccaagcaaacatggtttctgtgccaga
gatgaatgcaatccaggcattagcttcgcgcaatttctttagccagaatatcattgagggtggaggagctaccttcccac
agcaaaacaagaagattctccatcttgggtaa
back to top
>AB081093.1-MADS.m1714
atgggtcgtggaaagattgagatcaagctgatcgaaaaccagaccaacaggcaggtgacctactccaagagaagaaatgg
gatcttcaagaaggctcaggagctcaccgttctctgtgatgccaaggtctccctcatcatgctctccaacactagtaaaa
tgcacgagtatatcagccctaccactacgaccaagagtatgtatgatgactatcagaaaactatggggatcgatctatgg
aggacacactacgagtctatgaaagacaccttgtggaagttgaaagagatcaacaataagctgaggagagagatcaggca
gaggttgggccatgatctaaatggtctgagctatgacgatctccgttctcttgaggataagatgcaatcttccttagatg
ccatacgtgaaagaaagtaccatgtgatcaaaactcaaacggagaccaccaagaagaaggttaagaacttggaggaaaga
agaggaaacatgctgcatggctatgaagctgccagtgagaatccacaatattgttatgtggacaatgagggagactatga
atctgcacttgtgttggcaaatggggcaaataacttgtacactttccagctccaccgcaactccgaccagctccaccacc
ctaacctccaccaccacagaggaagttcgctcggctcctccatcactcatctacatgatctccgccttgcttga
back to top
>AB081092.1-MADS.m1574
gaatgggattatcaagaaagcaaaggagatcactgttctatgtgatgctaaagtatctcttatcatttattctagctctg
ggaagatggttgaatactgcagcccttcaactacgctgacagaaatcttggacaaataccatggacaatctgggaagaag
ttgtgggatgctaagcatgagaacctcagcaatgaagtggatagagtcaagaaagacaatgacagcatgcaagtagagct
caggcatctgaagggagaggatatcacatcattgaaccatgtagagctgatggccttagaggaagcacttgaaaatggcc
ttacaagtatccgggacaagcagtccaagttcgtcgacatgatgagagacaatggaaaggcactggaagatgagaataag
cgcctcacttatgagctgcaaaaacaacaggagatgaaaatagaagagaatgtgagaaacatggaaaatgggtatcatca
gaggcagctggggaactacaacaacaaccagcagcagataccttttgccttccgcgtgcagcctattcagccaaatctcc
aggagagaatctaa
back to top