MADS, MADS (gene) Rosa rugosa

Gene Overview
Name MADS
Gene Symbol MADS
Type gene
Organism Rosa rugosa
Synonym MADS-box protein
MASAKO
C1
B3
C2
S1
C3
BP
euB3
D1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSRosa rugosagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADSAB099875.1-MADS.m1Rosa rugosamRNA
MADSAB099876.1-MADS.m1Rosa rugosamRNA
MADSAB055966.1-MADS.m1Rosa rugosamRNA
MADSAB038462.1-MADS.m1Rosa rugosamRNA
MADSAB025646.1-MADS.m1Rosa rugosamRNA
MADSAB025645.1-MADS.m1Rosa rugosamRNA
MADSAB025644.1-MADS.m1Rosa rugosamRNA
MADSAB025643.1-MADS.m1Rosa rugosamRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AB099875.1-MADS.m1 N/A AB099875.1
mRNA parsed from NCBI nr database AB099876.1-MADS.m1 N/A AB099876.1
mRNA parsed from NCBI nr database AB055966.1-MADS.m1 N/A AB055966.1
mRNA parsed from NCBI nr database AB038462.1-MADS.m1 N/A AB038462.1
mRNA parsed from NCBI nr database AB025646.1-MADS.m1 N/A AB025646.1
mRNA parsed from NCBI nr database AB025645.1-MADS.m1 N/A AB025645.1
mRNA parsed from NCBI nr database AB025644.1-MADS.m1 N/A AB025644.1
mRNA parsed from NCBI nr database AB025643.1-MADS.m1 N/A AB025643.1

Sequence(s):
>AB099875.1-MADS.m1690
atggcgagaggtaagatccagatcaagaggatagagaacgtgacgaataggcaggtcacctactccaagagaaggaacgg
cctgttcaagaaggccaatgagctcactgttctctgtgatgctaaggtttctctcctcatggtttcctcttccggaaagc
ttcatgaattcatcagcccctccaccacgacaaagcaagtgtacgatgagtaccagaagctcctcggaattgacctttgg
aaatcgcactatgagacaatgcaagaaaatttgaagaagctgaaagagataaataagagtcttaggaggcagatcagcca
cagggtgggcgagtgtttgaacgatctgagattcgctgaactgcacagtcttgagaaagaaatggaaagcgctgtagaag
ttgttcgtaatcgcaagctgaagctgatctccaatcagattgataccaagaggaaaaagattcggaatgcaacagagtgc
aacaggagactctatgaatatgatgcaatggaggaaccacactacggattggttgacgatggaggagattattatgattc
tgccgtcattggctactcagcaaatgaagaccctcacaatgtatttcctttaaggctgcaaccttctcatcatcctaatc
ttcaccgcggaggaggaagttcagatcttacgacctactctttgctttga
back to top
>AB099876.1-MADS.m1655
aaatgggctcttaaagaaagcttatgagctctctattctctgtgatgctgaggttgctctcatcatcttctctaaccgtg
gcaagctctatgagttctgcagcagctccagcatactcaaaacccttgaaaggtaccaaaaatgtagctatggtgcaatg
gaagtcaacgaacctgccaaggaacttgagcagagcagctatcgtgaatacttgaaactgaaaactagatgcgagtctct
tcaacgaactcagagaaaccttcttggagaagacttgggcccattaaacacgaaggagcttgagcagcttgagcgtcagc
tagagtcctccttgaagcatgttaggtctacaaagacccagtatatgctcgatcagctttctgaccttcagagcaaggaa
catatgctaatagaagccaacagagatttgacaatgaagttggatgaaattaattcaggaactcaacttagacaaacatg
ggaacgtggtcatgctcaccagactatgctatatggaactcaacatgctcaaacccagggtcttatgttccagcctttag
attgcaatcccaccttgcaaatagggtacaacgctgtggggtcacagcaaatgactgcagccacaccagcccctactcaa
ccagtcaatggtttc
back to top
>AB055966.1-MADS.m1786
atgggtcgtgggaagattgagatcaagctgatcgagaaccagacgaacaggcaggtgacctattcgaagcgacgaaatgg
gatcttcaagaaggctcaggagctcacggttctgtgtgacgctcaggtctccctcatcatgcagtcctccactgacaaaa
tccacgagtatattagccctaccactacgaccaagaagatgtttgatctctaccagaagaatttacagatcgatctatgg
agctcacactacgaggcaatgaaagagaacttgtggaaactgaaagaggttaacaataagctgaggagggacatcaggca
aaggctggggcatgatcttaatggtctgagctatgctgagctgcaagatctggaggaaacgatgagtcaatccgtgcaaa
tcatacgtgatcgaaagtaccacgtgctcaagactcaagcagagactaccaggaaaaaggtgaagaacttggaggagaga
aacagtaatttaatgcatggctatggagctccaggtaatgaggatccccaatatgggtatgtggataatgaaggggacta
tgaatctgctgttgcattggccaatggagcatcaaacttgtattttttcaatcgcgtccacaacaaccacaaccttgacc
atggacatggtggcggttcactggtctcctccattactcatctccagaaccctaataaccacggcaaccacaaccttgag
aatggacatggtgggggttcactcatttcctccatcactcatctccatgatctccgtcttgcttaa
back to top
>AB038462.1-MADS.m1612
atggggaggggtaagattgagattaagaggattgaaaactcaagcaacaggcaggtgacctattctaagagaaagaatgg
gatcatcaaaaaggctaaggaaatcactgttctttgtgatgctaaggtttctcttattatcattgctagctctggaaaaa
tggttgaatactgcagcggccctcaggaaacgcggatgaaaatcttggacaaataccactcacagtctggaaagaggtta
tgggatgccaagcatgagaacctctgcaatgaagtggatagagtcaagaaagacaatgatggcatgcaaattgagcttcg
gcatttgaagggggaagacataacatctctgaaccatgtggacctgatggccttagaggaagcaattgaaaatggccttg
caagtatcagagacagaatgtcgaagtacatggacgcggttagagaaaataacagagctctggaggacgagaataagcgc
ctcgcatatcagctgcacaaaatgatgaaatctgaagagaatttgagggacatgaactacaacaacaacactcagatacc
ttttgccttacgtgtccagcctaatcagccaaatctccacgacagaatgtaa
back to top
>AB025646.1-MADS.m1753
atggcctatgaaaacaaacccaacacggtcctggactctgatgcccaaagaagattgggaaggggaaagatcgagatcaa
gcggatcgaaaacaccaccaatcgtcaagtcaccttctgcaaaaggcgcaatggtttgctcaagaaggcctatgagctct
ctgtgctctgtgatgctgaggttgctctcatagtcttctctaaccgtggccgtctctatgagtattccaacaacagtgtt
agagaaacaattgaacgatacaagaaggcatgtgcagattcttcaaataatggatctgtctctgaagctactactcagta
ctatcagcaagaagctgccaaactgcgtgcccagataaccactttgcagaacagtaacaggggttatatggctgagggtt
tgagcaatatgtctatcaaggagctcaagggcgtggagaccaaacttgagaaagcaattagcagaattagatccaagaag
aacgagctcttgtttgccgaaattgagtacatgcagaaaagggaacttgacttgcacaacaataaccagctcctccgagc
aaagggacagatagctgagaatgagaggcaccagcaaagcataaatgcgattgcaggtgggcatggaagctacgacatca
tgcagccgactcagccatttcatgaggctcgcaactattttcaagtgaatgctttgcaacccaatatccatcagtactcg
cgccatgaccagatttcccttcaattagtttga
back to top
>AB025645.1-MADS.m1750
atggcctatgaaaacaaacccaacacggtcctggactctgatgcccaaagaagattgggaaggggaaagatcgagatcaa
gcggatcgaaaacaccaccaatcgtcaagtcaccttctgcaaaaggcgcaatggtttgctcaagaaggcctatgagctct
ctgtgctctgtgatgctgaggttgctctcatagtcttctctaaccgtggccgtctctatgagtattccaacaacagcagt
gttagagaaacaattgaacgatacaagaaggcatgtgcagattcttcaaataatggatctgtctctgaagctactactca
gtactatcagcaagaagctgccaaactgcgtgcccagataaccactttgcagaacagtaacaggggttatatggctgagg
gtttgagcaatatgtctatcaaggagctcaagggcgtggagaccaaacttgagaaagcaattagcagaattagatccaag
aagaacgagctcttgtttgccgaaattgagtacatgcagaaaagggaacttgacttgcacaacaataaccagctcctccg
agcaaagatagctgagaatgagaggcaccagcaaagcataaatgcgattgcaggtgggcatggaagctacgacatcatgc
agccgactcagccatttcatgaggctcgcaactattttcaagtgaatgctttgcaacccaatatccatcagtactcgcgc
catgaccagatttcccttcaattagtttga
back to top
>AB025644.1-MADS.m1747
atggcctatgaaaacaaacccaacacggtcctggactctgatgcccaaagaagattgggaaggggaaagatcgagatcaa
gcggatcgaaaacaccaccaatcgtcaagtcaccttctgcaaaaggcgcaatggtttgctcaagaaggcctatgagctct
ctgtgctctgtgatgctgaggttgctctcatagtcttctctaaccgtggccgtctctatgagtattccaacaacagtgtt
agagaaacaattgaacgatacaagaaggcatgtgcagattcttcaaataatggatctgtctctgaagctactactcagta
ctatcagcaagaagctgccaaactgcgtgcccagataaccactttgcagaacagtaacaggggttatatggctgagggtt
tgagcaatatgtctatcaaggagctcaagggcgtggagaccaaacttgagaaagcaattagcagaattagatccaagaag
aacgagctcttgtttgccgaaattgagtacatgcagaaaagggaacttgacttgcacaacaataaccagctcctccgagc
aaagatagctgagaatgagaggcaccagcaaagcataaatgcgattgcaggtgggcatggaagctacgacatcatgcagc
cgactcagccatttcatgaggctcgcaactattttcaagtgaatgctttgcaacccaatatccatcagtactcgcgccat
gaccagatttcccttcaattagtttga
back to top
>AB025643.1-MADS.m1750
atggagttcccaaaacaaattacaccagctgatgatcctgagagctcttcccaaaagaaattgggaagagggaaaatcga
gatcaagaggatcgaaaacactaccaatcgacaagtcacattctgcaagcgccgcaacggtttgcttaagaaagcatatg
aactatctgttctttgtgatgctgaagttgctcttattgttttctctacccgggggcgcctctatgaatatgctaacaac
agtgttagagcaacaatcgaaaggtacaagaaagcatgtgattcttcaaacactggatctgtaactgagactaatgttca
gttttatcagcaagaagcctccaaactaagaagacagataagagaaattcagaattcaaacaggcacatactaggtgaag
ctcttagcactttgaacgtcaaggaactcaagaacctagaaggaagattggagaaaggaatcagcagaataagatccaaa
aagaatgaaatgctgtttgctgaaatcgaatatatgcaaaagagggagatcgagctgcaaaatcataacaattttctgag
agcaaagattgctgaaaatgacagggcacaacagcagcaagcaaatatgatgccaggaacattatctgcgtatgatcaat
caatgcctcctcctcaatcatacgataggagctttctccctgtaatccttgagtccaatcaccactacaatcgccaaggg
cagaaccagacacctctccaacttgtttga
back to top