MADS, MADS (gene) Taihangia rupestris

Gene Overview
Name MADS
Gene Symbol MADS
Type gene
Organism Taihangia rupestris
Synonym MADS-box protein
Description NA
Comment transcription factor
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADSDQ248947.1-MADS.m1Taihangia rupestrismRNA
MADSDQ248949.1-MADS.m1Taihangia rupestrismRNA
MADSDQ248948.1-MADS.m1Taihangia rupestrismRNA
MADSDQ248946.1-MADS.m1Taihangia rupestrismRNA
MADSDQ248945.1-MADS.m1Taihangia rupestrismRNA
MADSDQ248944.1-MADS.m1Taihangia rupestrismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSTaihangia rupestrisgene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database DQ248947.1-MADS.m1 N/A DQ248947.1
mRNA parsed from NCBI nr database DQ248949.1-MADS.m1 N/A DQ248949.1
mRNA parsed from NCBI nr database DQ248948.1-MADS.m1 N/A DQ248948.1
mRNA parsed from NCBI nr database DQ248946.1-MADS.m1 N/A DQ248946.1
mRNA parsed from NCBI nr database DQ248945.1-MADS.m1 N/A DQ248945.1
mRNA parsed from NCBI nr database DQ248944.1-MADS.m1 N/A DQ248944.1

Sequence(s):
>DQ248947.1-MADS.m1630
atggggagaggtaagattgagatcaaaaggatagagaactcaagcaacagacaggtgacttatacaaagagaagaaatgg
gatcataaagaaggctaaggaaatcactgttctctgtgatgctaaagtttttgttatcatcgttcctagctctggaaaaa
tggttgatttccgcagcggtcccaaggaaacactgctgaaactcttggacaagtatcacgcacaggggggaaataagtta
tgggatcaaaagcatgagaacctcttcattgaaatagataaggtcaggaaagagaatgacggcatgcaaatcgagctcag
gcatatgaaaggagaagacatatcatctctgagccatttggacctaatgagcttagaggaagcactggaaattggcctct
caagtatcagagacaaaaaggcacaacatctggacgcggttatagataatacaagagctgtggaggatgagaataagcgc
ctccgatatgagctgcacaaacggggaaaaactgaagagaacatgatggagatggagatggaagatgggtatcatcagaa
aatgcagggtaactacaacgttgtcttccgtgtccagcctaatcagcctaatctccacgaccgaatgtaa
back to top
>DQ248949.1-MADS.m1687
atgggtaggaaaattgagatcaagaggatcgaaaacactactaactggcaagtcaccttctgcaagcgccgcaacggttt
gctgaagaaagcttatgaactatctgttctttgtgatgctgaagttgctcttattgtcttctctacccgtggacgcctct
atgaatatgctaacaacagtgtgagacaaacaatccaaaggtacaaaaagacatgcgattcttcaaacagtggatctgtt
actgaagccaatgttcagttttatcagcaagaagcatccaaattaagaagacagatccgcgaaattcagaattcaaacag
gcatatactaggtgaagctctcagcactttgaatgtcaaggaactcaagaacctagaaggaagattggagaaaggaattg
ggagaataagatccaaaaagaatgaaatgctgtttgctgaaatcgaatatatgcaaaagaaggagattgagctgcaaaac
cagaacaactttctgagagcaaagatagctgaaactgacaaggcacgtcagcagcaaacaaacatgatgccaggaacgtc
gtctgcgtatgatcaatcaatgcctcctcctcaaacatatgataggagcttcctccctgtaatcctcgagtccaatcaca
actacaatcgccaaggccagaaccagacacctctccaactcgtttga
back to top
>DQ248948.1-MADS.m1699
atgggtaggggaaagatcgaaatcaagaggatcgaaaacaccaccaaccgccaagtgaccttttgcaaaaggcgcaatgg
cttgctcaagaaggcctatgagctctctgtgctctgtgatgctgaggttgctctcatagttttctctaaccgtggccgtc
tctatgagtattcaaacaacagtgttagagaaacgatcgaacgatacaagaaggcgtgtgcagatacttcaaataatgga
tctgtctctgaagccactactcagtactatcagcaagaagctgccaaactgcgcaaccagataactgctttgcagaacaa
taacaggaattatatggctgaggggttggggaatatgtctgtcaaagaactcaagaatgtagagtctaaacttgagaaag
caattggcaagatcaggtccaagaagaatgagctcttgttttccgaaatagaatacatgcaaaagagggaacttgacttg
cacaacaataaccagatcctccgagcaaagattgctgagaatgagaggcaccagcaaagcataaatgctattgcaggagg
aggaggagcgcatggaagctatgagataatgcagtcggctcagtcatttcatgaggctcgcaactactttcaagtgaatg
cgctgcagcctaatcatcagtactcgcgccatgatcagatttctcttcagttagtttga
back to top
>DQ248946.1-MADS.m1717
atgggaagaggaaaagttgagatcaagcggatcgagaacccgacgagcaggcaagtgacctactcgaagagacgaaatgg
gatcatcaagaaagctaacgagctcgctgttctcgttgacgctcaggtctgcctcatcatgctctcctccactgaaaaaa
tcgtggagtacataagccctaccactacggtgaagaagatgattgatctgtaccagaagaacttgaagatcgatctatgg
agtgagcactatgaggcaatgaaagagactctgcggaagctgaaagaggtcaatactaagctgaagagggagattagtca
aaggacggggcaagatcagctgaatgatctgagcttaactgagctgatagatctggaggaaaatatgactacttctgtgg
cggtcatacgtgaaagaaagtaccatgtgatcaagcaacaaacagagaaaaggcagaagaaggtgaggagcttggaggag
agaaaccgcaatctaatacatggctatgaatctgcagttgaggtggatccacagtttggttatgtggacaatgatggtga
ctttgaatctgccgtggcactggcaaatggagcaaccaacttgtactccttcaatcgtgtccaaaacaaccctgatgacc
ccaacctcgacaatggacatggcggaggttcagccatgtcctccatcactcaactccacgatcttcgccttgcttaa
back to top
>DQ248945.1-MADS.m1777
atgggaagaggcaaggttcagctgaagcggatcgagaacaagatcagcagacaagtaacattctcgaagcgacggactgg
attgcttaagaaagctcatgagatctcagttctctgtgatgctgaggtagctttgattgtcttctccaccaaaggcaagc
tctttgagtactctacgaactccagcatggaggctatcttggagcgatatgaacaatattcttatgcagaaaggcagagc
atgggtattactgatccagaatcacagggaagctggtctatggaatatcccaagcttgcggcaaggattgaaatcttaca
gaggaaaataaggaattacacgggtgaggatttagaccccttgagcttgagggagcttcaaagtttggagcaacagattg
atacagctcttaagcgtgttcgagtaagaaagaaccaagtaatgcacgattccatttcggagattcagaaaaagcacagg
gcactgcaggagcaaaataaccagatgtcaaagaagctgaaggagaatgagaagcagtcgcaagcagtacctaataatca
gcagtcaaactccaccaccatcgtcctaatggcaccgccaccaccacaagctccacctcctcctgcaccactccctgctc
taactattggtggggctttcctggacagaagaaatgcaatggatgaagatagcgacgatcaacagggaagagctcaaact
cggccggtcagtaacacaggcatgccactatggatggttcgtggtttgaaccaataa
back to top
>DQ248944.1-MADS.m1750
atgggaaggggtagggttgagctgaagaggatagagaacaagatcaacaggcaggtaacattttcgaaacgaagaactgg
gttacttaagaaggcgcatgagatctctgtattgtgcgatgctcaggttggcctgatagtgttctctaacaaagggaagc
tctttgagtacgcatcggattcgtgcatggaaaatatgcttgaacgctatgagaggtactcgtatgcagagagacggcta
atggaacctgactttgaatcacagggtgactggaccttcgaatatgctagactgaaggtgaaagttgaacttctgcaaag
aaaccttagccactatttgggagatgatttggattccttgagtgtcaaggagattcaaagtttggagcaacagcttgaca
cagcccttaagcaaattcgatcaagaaaaaaccaactgatgaatgagtccatctctgagctgcagagaaaggagaaggca
atgcaggtgcaaaacaacttgcttacaaagaagattcaggagaaagagaaggatgtagcggcaacgcaagaggttcatat
ctgggagccgcaacagtatcagcaccagcaaaataatggctttcataggctaccacagcctctacttccttgtttgaata
tggggggcacacatcaaaatgatcagttctttcaaatgagggggaaccagctggatcttactcttgaaccatcattgtat
tcattcaaccttggatgctttacttcatga
back to top