COX1, COX1 (gene) Rubus occidentalis

Gene Overview
Name COX1
Gene Symbol COX1
Type gene
Organism Rubus occidentalis
Synonym cytochrome oxidase subunit 1
COI
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
COX1EU701210.1-COX1Rubus occidentalisgene
COX1EU701209.1-COX1Rubus occidentalisgene
COX1EU701208.1-COX1Rubus occidentalisgene
COX1EU701207.1-COX1Rubus occidentalisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
COX1EU701210.1-COX1.m1Rubus occidentalismRNA
COX1EU701209.1-COX1.m1Rubus occidentalismRNA
COX1EU701208.1-COX1.m1Rubus occidentalismRNA
COX1EU701207.1-COX1.m1Rubus occidentalismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cytochrome c oxidaseCOXRubus occidentalisgene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU701210.1-COX1 N/A EU701210.1
gene parsed from NCBI nr database EU701209.1-COX1 N/A EU701209.1
gene parsed from NCBI nr database EU701208.1-COX1 N/A EU701208.1
gene parsed from NCBI nr database EU701207.1-COX1 N/A EU701207.1
mRNA parsed from NCBI nr database EU701210.1-COX1.m1 N/A EU701210.1
mRNA parsed from NCBI nr database EU701209.1-COX1.m1 N/A EU701209.1
mRNA parsed from NCBI nr database EU701208.1-COX1.m1 N/A EU701208.1
mRNA parsed from NCBI nr database EU701207.1-COX1.m1 N/A EU701207.1

Sequence(s):
>EU701210.1-COX1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctcagccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatcttcaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttcccgtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top
>EU701209.1-COX1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctccgccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatcttcaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttcccgtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top
>EU701208.1-COX1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctccgccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatcttcaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttcccgtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top
>EU701207.1-COX1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctcagccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatcttcaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttcccgtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top
>EU701210.1-COX1.m1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctcagccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatcttcaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttcccgtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top
>EU701209.1-COX1.m1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctccgccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatcttcaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttcccgtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top
>EU701208.1-COX1.m1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctccgccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatcttcaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttcccgtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top
>EU701207.1-COX1.m1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctcagccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatcttcaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttcccgtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top