DOF11, DOF11 (gene) Malus x domestica

Gene Overview
Name DOF11
Gene Symbol DOF11
Type gene
Organism Malus x domestica
Synonym DOF domain class transcription factor
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
DOF11HM122542.1-DOF11.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
DOF domain class transcription factorDOFMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HM122542.1-DOF11.m1 Chr14:27266001..27267676
chr14:24429266..24430941
chr14:24463333..24465008
chr14:28891499..28893174
HM122542.1

Sequence(s):
>HM122542.1-DOF11.m1984
atgggtcataattctctgcaagtttgcatggattcatctgactggctacagggaacgattcgcgaggactctccgatgga
ctcgtcctcgccgttatccggtgacatgttaacgtgctcgaggccgttggtcgagcggaggctgaggccccagcatgaac
aagccctcaagtgccctaggtgcgattccacccacaccaagttttgctactacaacaactacagcctctcccaacctagg
tacttttgcaagacctgcagaaggtactggaccaaaggcgggacgctcagaaacatccccgtcggcggcgggtgtagaaa
gaacaagaaagtttcttccaagaaacccaatgatcagagcccttcatcgttgatgaaccaacaccaccaccctggatcat
cttcgtcgtcgatatctcacatcccaactgatctccacctttcttttcctgatcagatgcagttctcacacctcaataac
ttgatgcttggaagtaatatgaaccctagtagcttcatggacattagtaaccctagacctattgatttcatggagagcaa
gttggaggctatagtggggactgccaggaactatgatttcatggggggtggtgctgatttgggtatgatgggtggatatg
gaaataatatgggtggagttagtcatggattagaacatcagtcaagctttcatggcatttgctcatctccatttgggatg
tcatcaattgatgggcagaatggtaatttcatggacagttgccagaggttaatgttgccgtatgatcaagcaaatcatga
ggatcatcatcaaattaatgcaatggatgtgaaaccaaacacgaagctcttatcacttgagtggcaagaccaagctggtt
gctctgaccttggaaaggactcatttgggtacctcaatggcctaggatcatggagcaatgtgatgaacagttatgccccc
tccacaacaaatccattagtctaa
back to top