DOF1, DOF1 (gene) Malus x domestica

Gene Overview
Name DOF1
Gene Symbol DOF1
Type gene
Organism Malus x domestica
Synonym DOF domain class transcription factor
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
DOF1HM122540.1-DOF1.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
DOF domain class transcription factorDOFMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HM122540.1-DOF1.m1 Chr11:11348050..11349738
chr11:10477259..10478947
chr11:11477261..11478949
HM122540.1

Sequence(s):
>HM122540.1-DOF1.m1909
atggatccggcaagtggacaacaacaacaccaggaaatgtcagctcaatcactggacatgctggtctgctcaaaatccca
acagcagcagcaagacaggaagccaaggcctcagccagaacaagccctaaagtgtccaagatgtgactccacaaacacaa
agttctgttactacaacaactacagcctctctcagcccaggtacttctgcaagtcctgcagaaggtattggaccaaaggt
ggcaccctcaggaatgttcctgtgggtggaggctgcaggaagaacaagagatcatcgtcggcgaaacgagctcaggacca
accgctcacacccaattccaacccactcccagccctaggttatgactcaaatgacctcacccttgcatttgctaggctcc
aaaggcagcagtcatgtggtgggcagttagggtttgatgaccatgaccacatttctctcttgggaaatcccacaaatgcc
cctgatcataacattcttggaaaccctaattcagctcctaggtttcttgatgcactgaggactgggtttcttgagaccca
caatggtaatttccagaacttgtataactatgggtatgggaatgggaatttgggtgaggtggaagattgtggtggcggaa
tgggaatccaccacccatttgaagaaggcaccaccaactcaaccaccacagcagtgacagttacaacaatgaagcaagaa
ctgttcaatgcccaaagtgagagcagcaacagagttctgtgggggtttccatggcagatgaacggtggagatcatcattc
aaacatggtggggaatagtaatcacgagtatgattcaggaagagagagctggaatgggattgcttcatcttggcagcatg
gacttctgcacactactcccctcgtgtaa
back to top