DOF4, DOF4 (gene) Malus x domestica

Gene Overview
Name DOF4
Gene Symbol DOF4
Type gene
Organism Malus x domestica
Synonym DOF domain class transcription factor
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
DOF4HM122545.1-DOF4.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
DOF domain class transcription factorDOFMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HM122545.1-DOF4.m1 Chr14:21507556..21508963
chr13:11019747..11021154
chr13:11498022..11499429
HM122545.1

Sequence(s):
>HM122545.1-DOF4.m1948
atggatactgctcagtggccacagggaattgtggtgaaaccaatagatgagatagtgacaaactcatgccctaagcctgc
agcagctaataatttagagaggaaggcaaggcctcagaaggaacaagccctaaactgtccaaggtgcaactccaccaaca
ccaaattctgctactacaacaactacagcctcacacaaccaaggtacttctgcaagacttgcagaaggtactggactgaa
ggtgggtccctcagaaacatcccagttggaggtggttcaaggaagaacaagagatcttcatccttaaacaattccccatc
aacaacttctaacaattcttcttcttcctcagcatccaaaaggcttcctgatctgattcaccaaaaccctaaaattaacc
aatcccaagatctgaacctcactttcccatccactaatcaagatttcaggactattatctctgatcacttgcttaatcac
catcatcaacaatttccaaacaacaacatcaataacgaaaacaccaacaagcagcaaaaccacatttcttcttcttcccc
aacctctactactacaactacaacaacatcccacctttcagccttggagcttctcactgggttgacttctaggggtttga
actccttcatgcctatgccagtctcatcagaccccaacaacaacagcaatactgtatataatagtccctctggactaatt
aatcccatgcaagatttcaagccaactcttaatttttcaattgacgggcttggaagtgggtatgggagtcttcaaggtca
tcatgttcaagagagcagtgggaggcttttgtttccatttgaagatttgaagcaagctccttcaggaggtgggattaatg
aggagaacaaggagcatggagattcagctgggtattggactggaatgctaggaggaggatcatggtaa
back to top