DOF7, DOF7 (gene) Malus x domestica

Gene Overview
Name DOF7
Gene Symbol DOF7
Type gene
Organism Malus x domestica
Synonym DOF domain class transcription factor
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
DOF7HM122548.1-DOF7.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
DOF domain class transcription factorDOFMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HM122548.1-DOF7.m1 Chr15:2439143..2439890
chr1:26211337..26212084
chr1:32706196..32706943
HM122548.1

Sequence(s):
>HM122548.1-DOF7.m1747
atgccgtttgactctgccgacgcgctaatgcaaccgtcgatgacgacgagagtccagcacagcctgggccaccctccgcc
gcagcagaccgagccgcttcactgcccccgctgcgattctgacaacaccaagttctgctactacaacaattacaacctcg
cccagccacgccacttctgcaagtcctgccgccgatactggacccacggcggaaccctccgcaatgtccccgtcggcggc
gggtctcgcaagaacaccaagcgttctcgcccatcctgctcttcctcctcgggctcgccctcctcctcttcactgaccca
ggaggtcagctccgtcgcgcccgataaacccaattcctttccggtggaaccgaagcctgagacggcgacggatcacgaaa
aactgatggacctgaacgagagcgctgttgggaacggtggcttcacttctctgttgagtgctcagggcccacctgcatct
ggcttcatggcgtttagcgggttcgggtacgggttggggctcgggcaagggtttgacgaagtgggtactttcggctacga
cggcggcagaggagtgctcgcttatcccgatgtcggtgattttacaaatgttatccacaacaatggagctgtttctgggg
gttctgtcgggtgcaacacgtggcagattatgactggtggtgatggtgggatagcagagaacaatggtgattgctttgcc
tggccggagctggagacttccaagtaa
back to top