DREB1L, DREB1L (gene) Prunus avium

Gene Overview
Name DREB1L
Gene Symbol DREB1L
Type gene
Organism Prunus avium
Synonym dehydration responsive element binding protein 1 like protein
dehydratiion responsive element binding protein 1 like protein
DREB1-like
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
DREB1LAB080967.1-DREB1LPrunus aviumgene
DREB1LAB080966.1-DREB1LPrunus aviumgene
DREB1LAB080965.1-DREB1LPrunus aviumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
DREB1LAB080967.1-DREB1L.m1Prunus aviummRNA
DREB1LAB080966.1-DREB1L.m1Prunus aviummRNA
DREB1LAB080965.1-DREB1L.m1Prunus aviummRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
dehydration-responsive element-binding proteinDREBPrunus aviumgene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB080967.1-DREB1L N/A AB080967.1
gene parsed from NCBI nr database AB080966.1-DREB1L N/A AB080966.1
gene parsed from NCBI nr database AB080965.1-DREB1L N/A AB080965.1
mRNA parsed from NCBI nr database AB080967.1-DREB1L.m1 N/A AB080967.1
mRNA parsed from NCBI nr database AB080966.1-DREB1L.m1 N/A AB080966.1
mRNA parsed from NCBI nr database AB080965.1-DREB1L.m1 N/A AB080965.1

Sequence(s):
>AB080967.1-DREB1L390
atggacgtgtctcaactttccgactcggtcgaccagcccgagtcgagttctttgtccgacgtcagcttcaagactcgggg
gccttcttggtccgacggggaagtcatattggcgtcaagccggccgaagaagcgagccgggaggagggttttcaaggaga
cgaggcaccccgtttataggggtgtgaggaggaggaacaatgacaagtgggtttgtgaaatgagagagcccaacaacaag
aagtccaggatatggctcgggacttatccgacggcggagatggctgctcgtgcccatgacgtggccgcattggcgtttag
agggaagcttgcctgcctcaactttgctgactccgcgtggaggctgcccgtgccggcttccatggatcga
back to top
>AB080966.1-DREB1L723
atggacatgttcttctctcaactttcagactcggtcgaccagccccagtcgagtttgttgtccgacgccagcgtcaccac
tcgaggggcttcttgttccgacggggacgtcatattggcgtcgagccggccgaagaagcgagcggggaggagggttttca
aggagacgaggcacccggtttataggggtgtgaggaggaggaacaatgacaagtgggtgtgtgaaatgagagagcccaac
aagaagaagtccaggatatggctcgggacttatccgacggcggagatggctgctcgtgcccatgacgtggccgcattggc
gtttagagggaagcttgcatgcatcaactttgctgactcagcgtggaggctgcccgtgccggcttccatggataccatgg
atattcggagggcggccgcagaggcagctgaggggtttaggccggtggagtttggtggagtgtgcagcggcagcagtgat
gagaaggagagaatggtggtgcaggtggaagagaagaacaagaagggtagtgtgaacttggaaagaagcagaagcttgag
cttgtcctattgggatgaggaggaagtgtttcacatgcccaggttgcttcatgacatggctgaagggcttcttctttctc
catcgcaatgcttaggtggctacatgaatttggatgacatgggcaccgatgctgatgtcaaattgtggagtttctccatt
taa
back to top
>AB080965.1-DREB1L699
atggacatgatctacagccagctctctgatttagcttctatggaaaacccggatacgtcttcgttttcggacgccagcgt
tacggcccggcgagcttctctttcagatgaggaggtcatactggcgtccagctgcccgaaaaggcgggcggggaggaggg
ttttcaaggagaccaggcacccggtttataggggtgtgaggaggaggaacaacaacaagtgggtgtgtgagctgagagcc
cccaacaacaagaaggccaggatatggctcgggacttatccgacggctgagatggcggctcgtgcccatgatgtcgctgt
attggcgtttagggggaagcttgcctgcctcaactttgctgactcggcttggcggctgcctgtgcctgcctccaccgatg
ccgcggagattaggagggcggccaccgaggccgctgaagcgtttaggcaggcggaggatggtggtgttgatgagaaggag
agtaaggcagtggtgagtgaggagaagggttgtgtaggaatggagggaagcagcaacttgttttatttggacgaggacga
aatatttgagatgccaaggttgcttgatgacatggctgatgggattatgctttgtccacctcaatgcttagatggctaca
tggattggaatgacgtggaaactgttgacgatttgaaactgtggagtttttctatttga
back to top
>AB080967.1-DREB1L.m1390
atggacgtgtctcaactttccgactcggtcgaccagcccgagtcgagttctttgtccgacgtcagcttcaagactcgggg
gccttcttggtccgacggggaagtcatattggcgtcaagccggccgaagaagcgagccgggaggagggttttcaaggaga
cgaggcaccccgtttataggggtgtgaggaggaggaacaatgacaagtgggtttgtgaaatgagagagcccaacaacaag
aagtccaggatatggctcgggacttatccgacggcggagatggctgctcgtgcccatgacgtggccgcattggcgtttag
agggaagcttgcctgcctcaactttgctgactccgcgtggaggctgcccgtgccggcttccatggatcga
back to top
>AB080966.1-DREB1L.m1723
atggacatgttcttctctcaactttcagactcggtcgaccagccccagtcgagtttgttgtccgacgccagcgtcaccac
tcgaggggcttcttgttccgacggggacgtcatattggcgtcgagccggccgaagaagcgagcggggaggagggttttca
aggagacgaggcacccggtttataggggtgtgaggaggaggaacaatgacaagtgggtgtgtgaaatgagagagcccaac
aagaagaagtccaggatatggctcgggacttatccgacggcggagatggctgctcgtgcccatgacgtggccgcattggc
gtttagagggaagcttgcatgcatcaactttgctgactcagcgtggaggctgcccgtgccggcttccatggataccatgg
atattcggagggcggccgcagaggcagctgaggggtttaggccggtggagtttggtggagtgtgcagcggcagcagtgat
gagaaggagagaatggtggtgcaggtggaagagaagaacaagaagggtagtgtgaacttggaaagaagcagaagcttgag
cttgtcctattgggatgaggaggaagtgtttcacatgcccaggttgcttcatgacatggctgaagggcttcttctttctc
catcgcaatgcttaggtggctacatgaatttggatgacatgggcaccgatgctgatgtcaaattgtggagtttctccatt
taa
back to top
>AB080965.1-DREB1L.m1699
atggacatgatctacagccagctctctgatttagcttctatggaaaacccggatacgtcttcgttttcggacgccagcgt
tacggcccggcgagcttctctttcagatgaggaggtcatactggcgtccagctgcccgaaaaggcgggcggggaggaggg
ttttcaaggagaccaggcacccggtttataggggtgtgaggaggaggaacaacaacaagtgggtgtgtgagctgagagcc
cccaacaacaagaaggccaggatatggctcgggacttatccgacggctgagatggcggctcgtgcccatgatgtcgctgt
attggcgtttagggggaagcttgcctgcctcaactttgctgactcggcttggcggctgcctgtgcctgcctccaccgatg
ccgcggagattaggagggcggccaccgaggccgctgaagcgtttaggcaggcggaggatggtggtgttgatgagaaggag
agtaaggcagtggtgagtgaggagaagggttgtgtaggaatggagggaagcagcaacttgttttatttggacgaggacga
aatatttgagatgccaaggttgcttgatgacatggctgatgggattatgctttgtccacctcaatgcttagatggctaca
tggattggaatgacgtggaaactgttgacgatttgaaactgtggagtttttctatttga
back to top