DREB1, DREB1 (gene) Malus x domestica

Gene Overview
Name DREB1
Gene Symbol DREB1
Type gene
Organism Malus x domestica
Synonym dehydration-responsive element-binding protein
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
DREB1JQ669815.1-DREB1.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
dehydration-responsive element-binding proteinDREBMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly JQ669815.1-DREB1.m1 Chr06:17755035..17756249
chr6:12937148..12938363
JQ669815.1

Sequence(s):
>JQ669815.1-DREB1.m11008
atgtatatatacgagaagcggtttcctccaagcagcattactccacctttgtgtgggaacttcggaacttgcctatgcgg
gcaacattttctccacctggcgcctcctcacactccgtgtacaacttgcgtggtcctgggtcccactcaaagtcttagca
atccacaaaaaaaaccaacagctataagatccacctcactctctctccaattttcaacttacaactccaaaaagaagtgt
agtactgaaacacactctcaactcacggctcaatttctccgacgcagcaccacaaaaatgaatacgatcttcagtactca
actctccgattcctccgaaaagcccgaatcgagttccgacgacacaagcatcacggctcaaagccagctggcttccttct
ccgacgaggaggtcattttggcgtccagccggcctaagaagcgagcggggaggagagttttcaaggagacgaggcaccca
gtttacagaggagttaggaggaggaacaacaacaagtgggtgtgcgaaatgagggaaccaaacaagaagaagtcgaggat
atggctcggaacttatccgacggccgagatggcagctcgggcgcatgacgtggcggcattggcctttagagggaagcttg
cctgcctcaattttgcagactccgcatggcgcctgcctgttccggcatccattgattcagcggatatcagacgggcggct
gcggaggctgcagagacgttccggtcagcggagtttggcggagtgttggaaagcggcgatgatgagaaggagagcaagaa
aatggaggaggagaaggattgtggaggcgtggagggaagtggaatcttgttttacttggatgaggaggaaatgttcgaca
tgccaaggttgctggatagtatggcggaagggcttctgctctctccgccgcactcttcaggtggctacatgaactgggat
gacatgggaagcaatgatgacgtcagtctgtggagcttctcaaattga
back to top