DREB2-3, DREB2-3 (gene) Malus x domestica

Gene Overview
Name DREB2-3
Gene Symbol DREB2-3
Type gene
Organism Malus x domestica
Synonym dehydration-responsive element-binding protein (DREB2)
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
DREB2-3JQ669818.1-DREB2-3.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
dehydration-responsive element-binding proteinDREBMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly JQ669818.1-DREB2-3.m1 Chr12:25979977..25981671
chr12:25157602..25159296
JQ669818.1

Sequence(s):
>JQ669818.1-DREB2-3.m11260
atggcgtccgaggcttccgacggggataggaaattgcggaagaggcgctacgggtgcgattcgatagaggacactctggc
taggtggaagaactacaatgagaggcttgattttgaaaaagatggagggaagaagactcggagggttcccgcgaagggct
ccacaaaagggtgtatgagagggaaaggagggcctgagaactccgcttgtgtttacaggggtgttaggcagaggacttgg
ggaaaatgggtggcggaaatccgagaaccgattcacgctacaggcggcgctgtaccgaagaagaagaataaccgtctttg
gcttgggactttccctacagcctgggaagctgcacttgcttatgataaagctgcttgggcaatttatggtgcttcggccc
ggctcaacttcgcaaagaacaccatggatttgaaggactcctgctctaattttgtgtcacccacaacgactaaaccatcg
tcctacgagtcatcgtcaacatataacagtgcggatcaggcaaaggaaagatcgggtttctttgaggactgtctgcccgg
agagccgaagcaggaaatggtttgtgctgtgggattggtgactgaggaattagagctttccaatgctaccttaagagacg
gttgcaacccttcaaatgatgtcaaatttgagacaccggcaatgagggaagcagtggtgaaagagttcccggtgattctg
gaatctggaagccaaaatggcttagatgatatgtacaacaatatgcataacgagcagaaaaatgttcaatctgatgatgc
tggaatgaagggatcgataactggtcaacaattgcagggaggtttagcagaaactacgaaattaaatggccataatcacg
atggcttcatacatacttatgcttacttagatgacttagacgataagtacaacaatagtccaggttatggcatcaatgca
tcgaatgacatcggaatgcagagggagctctacgacagacttgactacatgcataactgctggtctgcagaaaaaaccta
tggcattgatgctgctcaagaacaacaatgggagaggatgatgcattgtctccctatacaatttcagacacaaccacaag
tcgacatacctggaagctcgaatcatacgcaggacggatatttagacgtggatttcgattcagatttagttagacaaagc
tatcattccggtgtaatggaagagcaggggctgcattattcatggttcccttactcttag
back to top