DREB2, DREB2 (gene) Malus prunifolia

Gene Overview
Name DREB2
Gene Symbol DREB2
Type gene
Organism Malus prunifolia
Synonym dehydration-responsive element binding protein
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
DREB2JN204427.1-DREB2.m1Malus prunifoliamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
dehydration-responsive element-binding proteinDREBMalus prunifoliagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly JN204427.1-DREB2.m1 Chr12:7986304..7987162
chr12:6886608..6887466
chr12:6872821..6873679
chr12:8236489..8237347
JN204427.1

Sequence(s):
>JN204427.1-DREB2.m1858
atggataacagcagaaaatctccgttgaagccttggaagaaaggcccgacgagaggcaaaggcggccctcagaacgcctc
ctgcgaataccgcggcgttcggcaaagaacttggggcaaatgggtggctgaaatcagagagcctaagaagagaaccaggc
tgtggctgggctcttttgctacggctgaggaagctgccatggcctatgacgatgctgccaggagactctacggccccgaa
gcttttctcaaccttcctcaccttcaacccagctccaatccttcactcaaatctcaaaaattcaagtggttcccttccca
caacttcatttccatgtttccttcgtgcggtttgctcaacatcaatgcgcagccgagcgttcatgtcattcatcagaggc
tccaagaacttaagcaaaatggggttcttggtcacaccaccccttcctctagttcttcctcctgtgattcaaaatctgag
gctcacatcctgagtgacaaaaccgagatgcgaaatgttgcagagaaggagaaggatgtcgaaatttcatctgaaaaaga
ggcggaagactaccaggagaagccacagatggatctcaatgagtttcttcagcaactgggagtactgaacaaggagacac
aatcagaggcaactgagacaacagaaagttttacagctccggaattttcgatcggagaagttcatgatgaattcggaccc
tttgctgacaagaatatcaattgggatgcattgattgagatgcacgggatttcaaaccaaggagcagatgctggtacctt
tcaagtttacgatatgaatgaagagccttccttccccacttccatttggaacttctaa
back to top