DREB5-1, DREB5-1 (gene) Malus x domestica

Gene Overview
Name DREB5-1
Gene Symbol DREB5-1
Type gene
Organism Malus x domestica
Synonym dehydration-responsive element-binding protein (DREB5)
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
DREB5-1JQ669820.1-DREB5-1.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
dehydration-responsive element-binding proteinDREBMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly JQ669820.1-DREB5-1.m1 Chr15:49614192..49614798
chr15:40717681..40718287
chr15:40717623..40718229
chr15:40726294..40726900
chr15:47453781..47454387
chr15:47445110..47445716
JQ669820.1

Sequence(s):
>JQ669820.1-DREB5-1.m1606
atggaatcccaggctgcagactgccgcgtctctccggcaagatacaaaggagttcgcaagcgaaaatggggcaaatgggt
gtccgaaatccgcgaaccaggaaagaaaaccagaatatggctaggaagctacgaggcaccagaaatggcagctgcggcct
atgatgcagcggcattgcacctcaaagggtgtggggcggcgcttaattttcctgaaatggctgatagtcttccgaggccg
gccagttcaagcgcaatggacgtgcaactagcggctcaagaggctgcattgagggttagacgacagcagctgccaatgga
ggcatttccaaaggaggaggtgggtggctcgtcgaggggtttgagctcagcgccagtgacggtgggactgtctccgagtc
aaatccaggcgattaatgagtcgccgttggactcgccaaagatgtggatgcagtacatgtgcagggctcattgccatgag
gctccgtcgtcgttagggggagacctgtgggacactgataattccagtccaaacaagtactatgaaggtgatgtcgagtc
aatggactacgaagatatgcagcattggtccatttgggatccctag
back to top