DREB5-2, DREB5-2 (gene) Malus x domestica

Gene Overview
Name DREB5-2
Gene Symbol DREB5-2
Type gene
Organism Malus x domestica
Synonym dehydration-responsive element-binding protein (DREB5)
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
DREB5-2JQ669821.1-DREB5-2.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
dehydration-responsive element-binding proteinDREBMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly JQ669821.1-DREB5-2.m1 Chr15:17887544..17888258
chr15:15863248..15863962
chr15:17247993..17248707
JQ669821.1

Sequence(s):
>JQ669821.1-DREB5-2.m1714
atggtgaagcagacgattgggaagccctccgagcgaaacgacatcaagtacaagggcgtccgcaagcgcaagtggggcaa
atgggtgtcggaaatccgcctccccaacagccgggagcgaatctggttgggatcctacgacgcgcccgaaaaggcagcgc
gtgccttcgacgcggccctcttttgcttgcgcggccacactgccaagtttaatttccccgacaacccgcctgagatttcg
gggggaaggtccctgagcgcggcccagatccagacagaggcggcgaggttcgcgaattcggagcttccgaggagccacca
gtcgatgtcggagtttcaggcggagtctcagtcgatgtcggagttgcaggcggaatctcagtcgatgtcggagttgcggg
cggaatctcagtcgatgtcggagttgcaggcggagtcccggtctccgtccgtgtcggaggggagtgggaccgtcttcgtg
gaaagcgaatttctagtgactccaaacgattcgttttcggacccttttagcacattcgggtcgggtaattacgctacgga
gtacgggttgtttgcgggttttgatgaaatgaactatcagtttttcagtccagctgcggcggtgccaacgccggtcgttg
attactacgcggaagagaacttggacggtcagtttttcagtccggcccaggagtctttcctctggaatttctag
back to top