DREBA5, DREBA5 (gene) Malus sieversii

Gene Overview
Name DREBA5
Gene Symbol DREBA5
Type gene
Organism Malus sieversii
Synonym dehydration-responsive element binding protein
Description NA
Comment MsDREBA5
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
DREBA5JQ655768.1-DREBA5.m1Malus sieversiimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
dehydration-responsive element-binding proteinDREBMalus sieversiigene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly JQ655768.1-DREBA5.m1 Chr15:5382755..5383238
chr15:2216555..2217038
chr15:2216556..2217039
JQ655768.1

Sequence(s):
>JQ655768.1-DREBA5.m1483
atggaaggcgattactgctgctcttcgtcgtcttcttcctcaacgtccacgagcatggagaagcgtaagcatcctgatca
ccgccaagaaaagcaatacagaggaatacggatgaggaagtgggggaagtgggtggcggagattcgagaacccaacaagc
gctctcgaatttggctcggctcctacacgacccccatggctgccgcccgagcttacgacaccgccgttttctatcttcga
ggcccttctgcccgcctcaacttcccggaacttgtattccaagacgacggccagcagctccacgacatgtcggcggcttc
gatacggaagaaagctacggaggtcggggctaaggtcgacgctgttcaaaccgctctccgctcatcgccgacgtcgcagt
ccaaaacaacgttgagccggggtggctctttgaagcccgacttaaatgagtaccccgacccagaaaactccgatgaaagt
taa
back to top